| 00:01.20 | *** join/#debian Westie (~westie@unaffiliated/westie) |
| 00:01.36 | jelly-home | not really |
| 00:02.08 | jelly-home | !debian ooo |
| 00:02.08 | dpkg | <OpenOffice.org> in Debian has been following the fork at http://go-oo.org/ for several years, meaning that OOo in Debian has had a set of LGPLv3 patches that Sun refused to accept on the grounds of their licence. The fork at go-oo.org has joined the <libreoffice> project so while there's a change in name for the openoffice.org packages in Debian, there's little practical difference for users at this stage. |
| 00:02.25 | *** join/#debian centHOGG (~centHOGG@adsl-67-67-223-157.dsl.austtx.swbell.net) |
| 00:02.44 | unjudicial | so which is hte better version to install |
| 00:02.58 | jelly-home | the one that is available in your debian release |
| 00:03.41 | *** join/#debian Cibort (~Cibort@unaffiliated/cibort) |
| 00:04.09 | unjudicial | so that's openoffice |
| 00:04.52 | centHOGG | <0ffice 2003 |
| 00:05.52 | buu | Hey, can anyone make any suggestions as to how I can control the fans on a g5 with debian installed? I've run sensors-detect which came out with a couple of modules and suggested that I add them to the autoload system, so I did and ran the restart command, but running 'sensors' still gives me 'sensors-detect' |
| 00:06.09 | buu | Sorry, running sensors gives me No sensors found! |
| 00:06.29 | centHOGG | were you sudo |
| 00:06.56 | buu | centHOGG: Yes =] |
| 00:07.06 | ssfdre38 | where does the log-in debian image fall under for gnome |
| 00:07.23 | *** join/#debian swampy (~swampy@82.211.209.251) |
| 00:07.31 | centHOGG | at the end of sensor-detect did you have it write the script automatically |
| 00:07.33 | swilson06 | ugh, i forgot cisco made servers... just powered this old peace up and it came up cisco... darn |
| 00:07.34 | centHOGG | into the config |
| 00:07.38 | buu | centHOGG: Yep |
| 00:07.52 | swampy | Hi, I've used libvirt to passthrough USB keyboard to a guest, now that the guest is shutdown is there a way can use the keyboard as an input device on the host again without having to unplug it? |
| 00:07.52 | centHOGG | how many times did you try |
| 00:07.59 | buu | centHOGG: Well, I'm trying again.. |
| 00:08.02 | centHOGG | good |
| 00:08.05 | *** join/#debian ring2 (~ring0@unaffiliated/ring0) |
| 00:08.56 | buu | http://pastebin.com/Ym4avv3f |
| 00:09.01 | centHOGG | buu: after that exec bash |
| 00:09.05 | centHOGG | exec bash |
| 00:09.25 | unjudicial | i like how openoffice website now says "download for all OS except debian" |
| 00:09.26 | buu | Uh, ok? |
| 00:09.33 | unjudicial | haha. are they in a fight? |
| 00:09.50 | buu | centHOGG: Nothing appears to have changed. |
| 00:10.04 | centHOGG | hold on |
| 00:10.29 | *** join/#debian jhutchins_lt (~jonathan@64-151-37-66.dyn.everestkc.net) |
| 00:10.45 | centHOGG | buu: modprobe the new module |
| 00:10.51 | *** join/#debian Lesterwood (~gfdsg@c-68-40-197-123.hsd1.mi.comcast.net) |
| 00:11.00 | centHOGG | adm1021 |
| 00:11.03 | buu | centHOGG: You mean the adm1021? |
| 00:11.04 | buu | mmm |
| 00:11.20 | centHOGG | sudo modprobe |
| 00:11.23 | centHOGG | if you need to |
| 00:11.30 | buu | centHOGG: No output from modprobe, sensors command output still unchanged. |
| 00:11.37 | centHOGG | k |
| 00:12.25 | centHOGG | pm me |
| 00:12.33 | *** join/#debian dansushi (~dan@147.4.211.193) |
| 00:15.12 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 00:18.09 | unjudicial | is there a reason why nvidia won't install on linuxmint debian, when it installs fine on debian? |
| 00:18.24 | *** join/#debian Aim_Here (~bod@host81-152-113-96.range81-152.btcentralplus.com) |
| 00:18.54 | jelly-home | unjudicial: we don't know what Mint does, better to ask them |
| 00:19.15 | jelly-home | !lmde |
| 00:19.16 | dpkg | Linux Mint is not Debian and is not supported in #debian. Please use their forums at http://forums.linuxmint.com/ or join #linuxmint-help on irc.spotchat.org for support. Linux Mint is variously based on <Ubuntu> with a "Linux Mint Debian Edition" (LMDE) also available, based on <testing>. See also <based on debian>, <mintppc>. |
| 00:19.32 | unjudicial | i dont feel like going over there |
| 00:19.47 | jelly-home | if you're using that OS, that's the correct place |
| 00:20.32 | *** join/#debian None2 (~x@g231216218.adsl.alicedsl.de) |
| 00:20.49 | unjudicial | all right, fine. |
| 00:20.50 | *** join/#debian bman (~bman@sat-69-171-166-251.evdo.leapwireless.net) |
| 00:20.52 | unjudicial | it's basically the same os |
| 00:20.54 | jelly-home | this channel can barely support Debian issues, let alone derivatives that may change important stuff |
| 00:21.12 | unjudicial | they just add another repo, nonfree codecs, and a menu |
| 00:21.20 | jelly-home | they also mess with apt |
| 00:22.01 | unjudicial | how? |
| 00:22.03 | jelly-home | there was a person the other day who had weird Python stack traces from update-manager or that other apt GUI |
| 00:22.07 | xand | if it's all the same, why bother using it. |
| 00:22.12 | unjudicial | mint update |
| 00:22.14 | jelly-home | unjudicial: ask them. |
| 00:22.25 | unjudicial | because if i want to have a quick system and with current updates, it may fit the bill |
| 00:22.28 | xand | but yeah ask in there |
| 00:22.41 | unjudicial | instead of downloading 300mb of updates right after jus dling the iso |
| 00:22.47 | jelly-home | unjudicial: yup. And you lose #debian privileges ;-) |
| 00:23.17 | unjudicial | i dont like mint |
| 00:23.21 | unjudicial | i'm just saying |
| 00:24.36 | jelly-home | eash small distro brings some pluses (eg. flexibility, fast updates) and some minuses (smaller user base, less support) |
| 00:25.44 | unjudicial | do you use the 64 bit ? |
| 00:25.45 | centHOGG | haven't tried mint |
| 00:27.09 | unjudicial | it's basically tweaked to have all codecs installed |
| 00:27.26 | *** join/#debian gremset (ubuntu@117.192.107.148) |
| 00:29.37 | jelly-home | I've done a very cursory look on mint packages, and some of those seem to be on shaky legal grounds |
| 00:29.49 | *** join/#debian ZykoticK9 (~zykotick9@66.11.174.71) |
| 00:30.00 | jelly-home | (eg. Adobe Flash binaries aren't redistributable) |
| 00:30.01 | *** join/#debian Kraken (~kraken@a89-153-49-195.cpe.netcabo.pt) |
| 00:30.23 | metalfan_ | how can i check how often partition x was already mounted or when the next fsck is on boot? |
| 00:31.00 | *** mode/#debian [+l 1075] by debhelper |
| 00:31.40 | jelly-home | metalfan_: dumpe2fs -h /dev/yourfsdevice |
| 00:31.58 | jelly-home | that's assuming it's an ext[234]fs |
| 00:32.39 | *** join/#debian admin__ (admin@195.4.13.56) |
| 00:33.00 | centHOGG | any issues with ext4? |
| 00:33.01 | Boltsky | why would adobe make their binaries not redistributable... don't they WANT people to have flash? |
| 00:33.44 | jelly-home | Boltsky: they don't want people to get their flash from anywhere else than their web page. |
| 00:34.04 | jmarsden | Boltsky: They want to count downloads, get more visitors to their site, make sure they get "credit" in peoples minds for their work... who knows? Ask them... |
| 00:34.05 | \amethyst | in part so they can force you to get the latest versions |
| 00:34.14 | \amethyst | and all the things jmarsden said |
| 00:34.16 | centHOGG | trye |
| 00:34.20 | centHOGG | true |
| 00:34.20 | *** join/#debian faw (~faw@unaffiliated/faw) |
| 00:34.34 | *** join/#debian Benkinooby (~Benkinoob@214-50.203-62.cust.bluewin.ch) |
| 00:34.34 | *** join/#debian Benkinooby (~Benkinoob@unaffiliated/benkinooby) |
| 00:35.08 | unjudicial | Boltsky: they dont want it open source |
| 00:35.37 | jelly-home | unjudicial: redistributable != open source |
| 00:35.44 | Boltsky | that won't make it open source, the only thing it can do is increase market penetration |
| 00:36.03 | *** join/#debian mns (~mns@c-24-147-45-63.hsd1.ma.comcast.net) |
| 00:36.10 | jelly-home | centHOGG: ext4 seems a bit wonky for heavy usage, but fine for home. My personal rule of thumb is "if RHEL supports it, it's probably stable enough". RHEL started supporting it with RHEL 6. |
| 00:36.12 | unjudicial | or get bugs fixed, since the yare too incompetent to fix them |
| 00:36.20 | Boltsky | anyways, if they want to shoot themselves in the foot, that's fine with me |
| 00:36.33 | centHOGG | my only issue ext4 (so far).... long filenames |
| 00:36.47 | jelly-home | what about them |
| 00:36.47 | centHOGG | google went ext4 |
| 00:37.02 | centHOGG | ntfs has longer filenames ( it think) |
| 00:37.06 | centHOGG | I think |
| 00:37.18 | un214 | 255 not enough for you? |
| 00:37.19 | *** join/#debian Judas_PhD (~kevin@misterfluffy.dsl.xmission.com) |
| 00:37.26 | *** join/#debian asias (~asias@apicoo.com) |
| 00:37.28 | centHOGG | i was doing a sync to ext4 nas server... some names were too long |
| 00:37.30 | unjudicial | what exactly is the problem with ext4 vs. ext3? |
| 00:37.33 | jelly-home | I haven't triggered that issue in real life yet. |
| 00:37.34 | metalfan_ | jelly-home, thx |
| 00:37.44 | centHOGG | no biggie |
| 00:37.46 | un214 | (ntfs might support longer but win32 layer does not) |
| 00:37.52 | \amethyst | hm |
| 00:37.55 | centHOGG | interesting |
| 00:38.08 | \amethyst | ah, it's the "same" length but not really |
| 00:38.16 | \amethyst | NTFS supports 255 UTF-16 code units |
| 00:38.30 | centHOGG | ext4 seems pretty fast |
| 00:38.36 | jelly-home | \amethyst: that's 510 bytes |
| 00:38.43 | centHOGG | coming from ZFS (argh!!) |
| 00:39.06 | \amethyst | jelly-home: if your filenames are ASCII, it's 256 bytes from Linux's point of view |
| 00:39.33 | \amethyst | jelly-home: but once you have non-ASCII characters and you're using an encoding like utf8, it can become longer |
| 00:39.36 | metalfan_ | ive just reenabled lilo through the rescue mode that my hosting service provides, what ive done: installed grub2 via aptitude run grub-install /dev/sda and update-grub but after that the system did not boot? |
| 00:39.45 | jelly-home | \amethyst: but filenames aren't ascii. They're C NUL-terminated strings of anything but slash |
| 00:39.53 | centHOGG | UTF8 |
| 00:40.21 | metalfan_ | \amethyst, ah youre in here too |
| 00:40.40 | unjudicial | did you install with ext3? |
| 00:40.58 | metalfan_ | me? yes |
| 00:41.00 | jelly-home | metalfan_: why not just keep using lilo if it works |
| 00:41.08 | \amethyst | jelly-home: what I mean is, a windows filename (ignoring supplementary planes) has 256 characters |
| 00:41.21 | metalfan_ | update to squeeze is planned. thought i give it a try if it works |
| 00:41.26 | \amethyst | err, 255 |
| 00:41.33 | jelly-home | \amethyst: yeah, it's good to be the NTFS king |
| 00:41.45 | *** join/#debian bjk (~bjk@188.sub-75-246-164.myvzw.com) |
| 00:41.47 | jelly-home | they're much more sensible in that regard |
| 00:41.53 | \amethyst | jelly-home: which, to use it in Linux, would have to be encoded in either utf-8 or some similar encoding |
| 00:42.32 | \amethyst | since the embedded 0 bytes (and endianness issues) mean you can't use UTF-16 filenames directly in Unix |
| 00:43.00 | unjudicial | metalfan_: is that what you recommend? |
| 00:43.12 | centHOGG | guess which files have the longest filenames |
| 00:43.28 | metalfan_ | unjudicial, what did i recommendate? |
| 00:43.30 | \amethyst | so if every character were from ASCII, or if you are converting to an 8-bit encoding, everything should fit. But if you are converting to UTF-8, a Windows filename might not fit into an ext? filename |
| 00:43.34 | jelly-home | centHOGG: japanese pron? |
| 00:43.39 | unjudicial | ext3 |
| 00:43.54 | unjudicial | are you running debian 6 stable? |
| 00:43.56 | centHOGG | heh.... mp3s |
| 00:44.20 | centHOGG | i just autotag them |
| 00:44.22 | metalfan_ | unjudicial, i said the system is installed with ext3...i thought you were asking about my problem |
| 00:44.42 | jelly-home | centHOGG: move the artist and album names out of filenames and into directory structure |
| 00:44.42 | unjudicial | yes. both |
| 00:44.49 | metalfan_ | unjudicial, do you read every second line and skip some in between? |
| 00:44.57 | centHOGG | y |
| 00:45.01 | unjudicial | sorry. i have some adhd |
| 00:45.03 | *** part/#debian bjk (~bjk@188.sub-75-246-164.myvzw.com) |
| 00:45.13 | centHOGG | y as in yeah |
| 00:45.38 | metalfan_ | unjudicial, i see. ask a general question into the chan |
| 00:47.25 | *** join/#debian poncha|laptop (~poncha@unaffiliated/poncha) |
| 00:47.43 | unjudicial | for a normal install, do you recommend ext3 over ext4, and if so, what problems does ext4 have? |
| 00:48.09 | centHOGG | ext3 is going EOL in sept |
| 00:48.19 | centHOGG | i think |
| 00:48.55 | metalfan_ | eol = end of line? |
| 00:49.08 | centHOGG | y i think i saw that on wiki |
| 00:49.09 | jmarsden | centHOGG: Do you have the URL to the ext3 end of life notice? |
| 00:49.53 | jmarsden | Filesystems tend to stick around for a really long time... |
| 00:50.07 | un214 | ext2 is not EOL |
| 00:51.08 | simonlnu | it's like saying dns is eol last week |
| 00:51.14 | centHOGG | sorry my bad, kernel 2.4 is going EOL sept |
| 00:51.25 | simonlnu | that makes sense |
| 00:51.34 | centHOGG | :o |
| 00:51.35 | *** join/#debian timahvo1 (~rogue@41.223.57.75) |
| 00:51.47 | simonlnu | porbably just pure maintenance |
| 00:51.51 | simonlnu | pro* |
| 00:52.09 | jelly-home | it's been in maintenance for years now |
| 00:52.17 | jelly-home | so yeah, good riddance |
| 00:52.34 | simonlnu | i know, but i couldn't think of the proper word :/ |
| 00:52.45 | toropisco | ext4 is production ready and tested. The Debian installer defaults to ext3 because it is like buying IBM. No one has been fired for buying IBM... |
| 00:53.44 | jelly-home | toropisco: meh, I've triggered ext4 bugs a year ago or so |
| 00:53.47 | simonlnu | i forgot just how *long* is to build...</ot> |
| 00:53.48 | toropisco | Google not only uses ext4, it blows up the journal, so it is equivalent to ext2 but better because it uses extents. |
| 00:53.56 | simonlnu | build gimp* |
| 00:54.05 | *** join/#debian Benkinooby (~Benkinoob@214-50.203-62.cust.bluewin.ch) |
| 00:54.05 | *** join/#debian Benkinooby (~Benkinoob@unaffiliated/benkinooby) |
| 00:54.13 | centHOGG | ever try to resize ext3 in acronis? |
| 00:54.28 | toropisco | jelly-home: Four kernel versions back? That's in the Stone Age (or at least the Dark Ages) in IT time. |
| 00:55.03 | jelly-home | toropisco: yeah. Tell that to Debian. |
| 00:55.23 | *** join/#debian NMZ (~NMZ@fs.hulst.cosemans.be) |
| 00:55.30 | RichiH | ext3 going EOL? i highly doubt that |
| 00:55.43 | RichiH | mainly because ext2 is still supported ;) |
| 00:55.50 | jelly-home | centHOGG: ext3 has a native online tool for growing it |
| 00:56.03 | unjudicial | what's the reason for having ext2 and ext3 with ext4 around? |
| 00:56.06 | centHOGG | both ways? |
| 00:56.07 | toropisco | Reaoson why most Debian desktop users are in testing or sid and compile their own kernels, according to a poll I read in the planet a few days ago... |
| 00:56.16 | jelly-home | centHOGG: shrinking is offline |
| 00:56.31 | jelly-home | centHOGG: but how often do you shrink a fs |
| 00:56.32 | moniker326 | is there a package that set up apache and php to work with tmp folders for multiple sites? |
| 00:56.50 | *** join/#debian zezib (~IceChat77@modemcable004.103-81-70.mc.videotron.ca) |
| 00:56.54 | centHOGG | not often but setting up a server yeah |
| 00:57.05 | jelly-home | toropisco: was there a poll about Debian server users |
| 00:57.07 | RichiH | unjudicial: the reason to use ext3 is that ext4 is still too new |
| 00:57.21 | *** join/#debian LinuxGuy2009 (~mark@cpe-65-25-99-236.neo.res.rr.com) |
| 00:57.30 | *** join/#debian veebull (~monte@66.172.107.27) |
| 00:57.30 | unjudicial | RichiH: it's unstable |
| 00:57.31 | unjudicial | ? |
| 00:57.35 | *** join/#debian Auron (~auron@61.152.132.103) |
| 00:57.37 | RichiH | (i am using xfs and will continue to do so until btrfs or zfs are stable and a few years old, in linux) |
| 00:57.47 | RichiH | unjudicial: from what i hear, it's stable |
| 00:57.48 | centHOGG | zfs in linux? |
| 00:57.53 | RichiH | but it's too new for me to trust ut |
| 00:58.00 | moniker326 | or sample php.ini & apache2.conf files that work together well with tmp folders for multiple sites |
| 00:58.01 | unjudicial | RichiH: then define too new |
| 00:58.07 | RichiH | centHOGG: unlikely, but might happen |
| 00:58.09 | abrotman | centHOGG: it's only in FUSE |
| 00:58.26 | centHOGG | in zfs the filenames are a little longer :) |
| 00:58.36 | centHOGG | but I think its slow |
| 00:58.37 | RichiH | abrotman: some indian people have ported it from opensolaris to linux |
| 00:58.40 | toropisco | jelly-home: I don't recall, but I think not. Yet, think for a minute: In the desktop you want the latest and greatest, on the server you want it to be set in stone. I like Debian for that. |
| 00:58.59 | RichiH | but they are not compliant with the gpl & cddl, so me |
| 00:59.01 | RichiH | meh* |
| 00:59.04 | Arrowmaster | toropisco: i would think about 99.999% of desktop linux users do not compile their own kernels |
| 00:59.31 | centHOGG | compile=time |
| 00:59.35 | RichiH | then, there's the from-scratch implementation by llnl, but they only needed part of it and have no interest to implement the full stack |
| 00:59.51 | jelly-home | abrotman: http://zfsonlinux.org/ |
| 01:00.05 | Arrowmaster | its also rather complex and mostly just not worth it for the majority of desktop linux users |
| 01:00.05 | toropisco | Arrowmaster: it comes a time when Masai children grow up and to prove it become lion hunters. Same with kernels. |
| 01:00.17 | RichiH | unjudicial: "too new == last non-data-loss bug is less than two years ago" |
| 01:00.30 | centHOGG | time will tell |
| 01:00.36 | abrotman | creepy! |
| 01:00.52 | centHOGG | when google crashes because of ext4 that will be the sign |
| 01:01.14 | Arrowmaster | google uses their own filesystem |
| 01:01.16 | centHOGG | then butter |
| 01:01.43 | MrFrood | didn't google recently have to resort to back up tapes..? |
| 01:01.54 | centHOGG | sell them my seagate |
| 01:02.03 | RichiH | oh, pool version 28? |
| 01:02.10 | RichiH | that's newer than fuse zfs |
| 01:02.19 | MrFrood | thinks 9.5 inch tapes rock |
| 01:02.23 | toropisco | google doesn't put all its eggs in one basket you know. ext4 sans journal is just the basis of their hightly redundant and replicates data storage. |
| 01:02.31 | LinuxGuy2009 | Is there any way to get software-center to work with a trivial repository on my hard drive? It contains all of the packages from the 8 DVD repository set. I like being able to find new software in organized categories like in software-center. It works with the DVDs added as sources, but does not work with my trivial repository with the same set of packages. I just copied the pool contents from each DVD into a folder and merged the conten |
| 01:02.37 | *** join/#debian jenev (~jenev@72.51.87.168) |
| 01:02.43 | jenev | hey |
| 01:03.00 | *** join/#debian Tux^verdreifelt (Tux_verdre@piratenpartei/ni/tux) |
| 01:03.03 | *** join/#debian Fyrespray (~Mark@78.32.255.161) |
| 01:03.04 | jenev | where can i get the dev libraries for debian |
| 01:03.07 | centHOGG | tapes are somewhere stored around here |
| 01:03.14 | jenev | which cd are they on? |
| 01:03.25 | abrotman | depends which ones you want |
| 01:03.26 | simonlnu | jenev: apt-cache search foo dev |
| 01:03.28 | \amethyst | jenev: they're generally in packages with names like libfoo-dev |
| 01:03.31 | toropisco | LinuxGuy2009: reprepro and a file:/// line in your sources.list file. |
| 01:03.51 | RichiH | jelly-home: they are farther than i remembered |
| 01:03.53 | RichiH | neat. |
| 01:04.27 | jenev | so don't one of the cds have them? |
| 01:04.50 | \amethyst | nope, they're spread out |
| 01:05.01 | \amethyst | there don't appear to be any -dev packages on CD 1 or 2 |
| 01:05.13 | jenev | oh christ |
| 01:05.27 | jenev | so is there a range of cds? |
| 01:05.29 | abrotman | why not use http sources and make it easier on yourself? |
| 01:05.40 | RichiH | jenev: do you _have_ to use cds? |
| 01:05.52 | jenev | yes |
| 01:06.07 | \amethyst | jenev: from cd 3 to cd 52 |
| 01:06.09 | *** join/#debian LinuxGuy2009 (~mark@cpe-65-25-99-236.neo.res.rr.com) |
| 01:06.18 | jelly-home | *cough* |
| 01:06.19 | jenev | linux does not provide a driver for my network device |
| 01:06.19 | \amethyst | you might have better luck using jigdo to make your own CDs |
| 01:06.22 | jenev | thanks |
| 01:06.44 | \amethyst | but you probably don't need all the -dev libraries |
| 01:06.53 | RichiH | jenev: there are ways to generate a list of debs you want locally and grab the files from the net where you have internet access |
| 01:07.36 | centHOGG | no network linux driver? |
| 01:07.41 | *** join/#debian MUILTFN (~MLINTH@98.80.223.80) |
| 01:07.54 | *** join/#debian ymasory_ (~ymasory@c-76-99-55-224.hsd1.pa.comcast.net) |
| 01:07.55 | *** join/#debian neur0n (~jenev@69.73.201.104) |
| 01:09.13 | *** join/#debian neur0n (~jenev@69.73.201.104) |
| 01:09.34 | neur0n | yea what jigdo? |
| 01:09.40 | *** join/#debian xiangfu (~xiangfu@fidelio.qi-hardware.com) |
| 01:10.14 | *** join/#debian leo (~leo@116.247.108.254) |
| 01:10.50 | *** join/#debian gremset (ubuntu@117.192.107.148) |
| 01:11.24 | centHOGG | kinda hard to set up a linux server that doesn't like your nic |
| 01:11.27 | *** join/#debian master_of_master (~master_of@p57B55910.dip.t-dialin.net) |
| 01:14.52 | *** join/#debian hpdv (~hpdv@cpe-24-92-71-240.wi.res.rr.com) |
| 01:15.01 | hpdv | hi, this page tells me "Missing Plug-in": http://www.bbc.co.uk/urdu/radio/2009/03/090305_jahan_numa.shtml?bw=bb&mp=wm&bbcws=1&news=1 |
| 01:15.24 | hpdv | but I'm not sure what it's alluding to... any tips? and how I would go about getting the thing so I can listen to the audio? |
| 01:16.27 | *** join/#debian chipotle (~chipotle@209-6-67-222.c3-0.abr-ubr1.sbo-abr.ma.cable.rcn.com) |
| 01:17.44 | *** join/#debian xPhilosx (~asdfa@64-139-76-219-Pima.hfc.comcastbusiness.net) |
| 01:19.09 | xPhilosx | Are there any known bugs related to installing mysql-server and having password problems? For the first time in my life, on a vanilla install (3x in a row) aptitude install mysql-server has installed mysql and immediately using mysql -u root -p has resulted in error #1045 (bad pass) |
| 01:19.23 | xPhilosx | lenny repo's |
| 01:20.18 | tuv | what's your take on init replacements? e.g. runit, upstart, etc |
| 01:21.33 | toropisco | hpdv: The audio stream is windows media v8, so having totem-plugin and all the gstreamer plugins installed should do the trick. |
| 01:21.53 | *** join/#debian fender0107401 (~fender010@219.243.32.29) |
| 01:27.17 | *** join/#debian gremset_ (ubuntu@117.192.110.157) |
| 01:27.58 | *** join/#debian mns (~mns@c-24-147-45-63.hsd1.ma.comcast.net) |
| 01:29.27 | *** join/#debian poncha|laptop (~poncha@bzq-84-108-132-131.cablep.bezeqint.net) |
| 01:29.30 | *** join/#debian poncha|laptop (~poncha@unaffiliated/poncha) |
| 01:29.54 | *** join/#debian nixoeen (~nixoeen@gb076.stw.stud.uni-saarland.de) |
| 01:29.54 | *** join/#debian nixoeen (~nixoeen@unaffiliated/nixoeen) |
| 01:31.29 | *** join/#debian ConnorVM (~connor@ip72-204-33-197.fv.ks.cox.net) |
| 01:31.39 | freebird_2 | you guys, I can only play sound with mplayer, when I run thru a CLI, other way, no sound, I`ve removed alsa, reinstalled, compilled, installed all kinds of mixers, my alsamixer is working fine |
| 01:31.44 | freebird_2 | what could that be ? |
| 01:31.57 | centHOGG | pulseaudio? |
| 01:32.24 | freebird_2 | centHOGG, ? |
| 01:32.29 | freebird_2 | should I install it ? |
| 01:32.37 | centHOGG | are you after system sounds? |
| 01:32.50 | freebird_2 | centHOGG, yeah |
| 01:32.54 | centHOGG | try it |
| 01:33.10 | freebird_2 | well, I wish I could listen to music thru any player, not just mplayer thru cli |
| 01:33.19 | freebird_2 | web sites with music, etc, ok, I`ll try |
| 01:34.00 | *** join/#debian leo (~leo@116.247.108.254) |
| 01:36.30 | *** join/#debian ChrisPartridge (~az@219-90-195-66.static.adam.com.au) |
| 01:37.08 | None2 | freebird_2: paste output of mplayer -v $YOUR_MUSIC |
| 01:37.18 | *** join/#debian Quota (~Quota@52.136.159.110.tm-hsbb.tm.net.my) |
| 01:38.00 | *** join/#debian gremset (ubuntu@117.192.102.81) |
| 01:38.08 | freebird_2 | centHOGG, no success, same problem |
| 01:38.14 | centHOGG | ok |
| 01:38.15 | *** part/#debian trentg (~trentg@pdpc/supporter/active/trentg) |
| 01:38.16 | freebird_2 | None2, 2 min |
| 01:38.17 | *** join/#debian SSL` (~Unix@nat/hp/x-ndmjmixwrbzkgkqx) |
| 01:38.19 | freebird_2 | please, |
| 01:38.38 | *** join/#debian hedgehoginfog (~alex@c-68-82-180-17.hsd1.de.comcast.net) |
| 01:38.42 | centHOGG | no system sounds |
| 01:38.46 | centHOGG | in gnome or what? |
| 01:39.01 | hpdv | toropisco: having gotten totem/gstreamer plugins, it now just displays a blank instead of the "Missing Plug-in" text. any ideas on what should do now? |
| 01:40.06 | freebird_2 | None2, http://pastebin.com/kjhBKv2G |
| 01:40.17 | freebird_2 | centHOGG, yes, gnome |
| 01:40.34 | centHOGG | ok, pm me |
| 01:40.35 | toropisco | hpdv: hmmm... That means you will need to use the gstreamer plugins from debian-multimedia.org (I'm afraid help about those is outside the channel's charter). |
| 01:41.12 | freebird_2 | centHOGG, pm you ? |
| 01:41.16 | xPhilosx | Are there any known bugs related to installing mysql-server and having password problems? For the first time in my life, on a vanilla install (3x in a row) aptitude install mysql-server has installed mysql and immediately using mysql -u root -p has resulted in error #1045 (bad pass) |
| 01:41.17 | toropisco | hpdv: go to the site, add the repo and do an upgrade. |
| 01:41.24 | centHOGG | private message |
| 01:42.07 | hpdv | toropisco: sorry, go to which site? |
| 01:42.18 | hpdv | toropisco: oh,right |
| 01:43.16 | None2 | freebird_2: your alsa setup looks ok. i'd blame all the other apps that fail to play sound. try running to mplayers simultaneously. do the sounds mix? |
| 01:43.27 | hpdv | heh, sorry, haven't used deb in a while - what's the path of sources.lsit |
| 01:44.19 | hpdv | nvm, got it |
| 01:44.23 | freebird_2 | None2, you mean 2 player ? I only get one, the mplayer from cli, all other fails |
| 01:44.59 | None2 | freebird_2: yes, two mplayers. in separate terminals |
| 01:47.25 | freebird_2 | I see |
| 01:48.14 | *** join/#debian Soul_Eater (~marcelo@unaffiliated/soul-eater/x-4649632) |
| 01:50.25 | freebird_2 | None2, works in both |
| 01:50.33 | freebird_2 | None2, both playing |
| 01:51.01 | *** mode/#debian [+l 1067] by debhelper |
| 01:51.16 | *** join/#debian Noturno (~marcelo@unaffiliated/soul-eater/x-4649632) |
| 01:52.18 | None2 | freebird_2: well, i don't believe the "all other fails" part. what about vlc? |
| 01:52.38 | *** join/#debian r0fs3ck5 (~r0fs3cks@124-170-29-3.dyn.iinet.net.au) |
| 01:53.29 | freebird_2 | None2, I`ve it, but wont work, just doesn`t make any sound |
| 01:53.55 | *** join/#debian bixgomez (~bixgomez@c-24-16-37-138.hsd1.wa.comcast.net) |
| 01:53.56 | freebird_2 | None2, the mixers wont recognize the driver, they are not comunicatting |
| 01:54.12 | freebird_2 | pulseaudio wont connect |
| 01:54.42 | *** join/#debian gremset_ (ubuntu@117.192.105.4) |
| 01:55.57 | *** part/#debian mu (~mu@unaffiliated/mu) |
| 01:57.20 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 01:58.03 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 01:58.23 | *** part/#debian xPhilosx (~asdfa@64-139-76-219-Pima.hfc.comcastbusiness.net) |
| 01:58.40 | None2 | freebird_2: sorry. maybe the output of vlc -v2 Get\ Mad.mp3 gives you pointers |
| 01:59.22 | *** join/#debian muddo (debian-tor@gateway/tor-sasl/muddo) |
| 02:00.05 | *** join/#debian wols_ (~klingens@p4FEC4E8B.dip.t-dialin.net) |
| 02:00.14 | None2 | freebird_2: or rather, mplayer -ao pcm Get\ Mad.mp3; vlc -v2 audiodump.wav |
| 02:00.48 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 02:01.46 | *** join/#debian dspace (~dspace@74-131-161-158.dhcp.insightbb.com) |
| 02:03.54 | *** join/#debian overchan (~goldfinge@p57B976DB.dip.t-dialin.net) |
| 02:04.36 | *** join/#debian Floops (~baihu@2001:470:a073:0:a00:27ff:fea2:c438) |
| 02:06.42 | *** join/#debian Andorin (~anon@unaffiliated/andorin) |
| 02:07.38 | *** join/#debian ellisgeek_ (~ellisgeel@66-190-33-174.dhcp.fdul.wi.charter.com) |
| 02:09.31 | jhutchins_lt | Wait, we ADDED pulseaudio? Why? |
| 02:11.00 | *** mode/#debian [+l 1058] by debhelper |
| 02:12.24 | *** join/#debian freebird_2 (~freebird@189.62.55.25) |
| 02:13.49 | *** join/#debian Julius_Brazil (~julius4@201-10-161-53.pvoce701.dsl.brasiltelecom.net.br) |
| 02:13.54 | Julius_Brazil | I'm looking for some gadgets to install on my desktop. I use debian with gnome 2 |
| 02:13.54 | Julius_Brazil | I'm checking some screenlets and found some beautiful. I'm using conky. |
| 02:14.26 | freebird_2 | Julius_Brazil, e ai mlkao, fmzzz |
| 02:14.34 | abrotman | !gdesklets |
| 02:14.34 | dpkg | gDesklets is a system for bringing mini programs (desklets), such as weather forecasts, news tickers, system information displays, or music player controls, onto your desktop, where they are sitting there in a symbiotic relationship of eye candy and usefulness. The gdesklets-data package was removed from Debian post-Lenny to resolve bug #585377. http://www.gdesklets.de/. |
| 02:14.40 | abrotman | doh .. removed! :( |
| 02:14.48 | Julius_Brazil | oooooooooooowwwwwwwww, tnks tnks tnks tnks tnks |
| 02:15.19 | freebird_2 | you guys, where`s centHOGG |
| 02:15.31 | Julius_Brazil | freebird_2, opa, como vai ? |
| 02:15.35 | freebird_2 | my gnome went crazy in here, internet went down, had to restarat |
| 02:15.37 | freebird_2 | restart |
| 02:15.45 | freebird_2 | Julius_Brazil, noixx garoto |
| 02:16.02 | *** join/#debian sdx23 (~sdx23@unaffiliated/sdx23) |
| 02:16.15 | *** join/#debian HardDisk_WP (~marco@velirat.de) |
| 02:16.15 | *** join/#debian HardDisk_WP (~marco@wikipedia/harddisk) |
| 02:16.36 | Julius_Brazil | freebird_2, o site http://www.gdesklets.de/ esta desativado |
| 02:16.52 | *** join/#debian leo (~leo@116.247.108.254) |
| 02:17.07 | *** join/#debian omeddragon (~omeddrago@pool-71-178-234-18.washdc.fios.verizon.net) |
| 02:17.11 | freebird_2 | Julius_Brazil, mas o que vc quer fazer ? so uns applets mesmo ? |
| 02:17.19 | Julius_Brazil | freespace, sim sim |
| 02:17.23 | Julius_Brazil | freebird_2, sim sim |
| 02:17.26 | jhutchins_lt | freebird_2:Why are you using pulseaudio? Of course the mixers can't do anything if pulse is in the way. |
| 02:17.42 | Julius_Brazil | freebird_2, queria uns applets bonitos né, rs |
| 02:17.43 | abrotman | english here |
| 02:17.49 | abrotman | Julius_Brazil: freebird_2 english only here |
| 02:17.50 | abrotman | !br |
| 02:17.50 | dpkg | Este canal é apenas em inglês. Por favor, use #debian-br (/j #debian-br) para ajuda em portugues. |
| 02:18.24 | *** join/#debian cascardo (~cascardo@187.59.181.92) |
| 02:18.27 | jhutchins_lt | The idea of a public channel is that we can all follow along or pitch in, which doesn't work if we don't know your language. |
| 02:19.05 | *** join/#debian dudz__ (~dudz_@123-243-44-131.static.tpgi.com.au) |
| 02:19.15 | Julius_Brazil | debian-devel channel with this problem. he makes a strange redirection |
| 02:19.27 | freebird_2 | Julius_Brazil, tem o beryl, comp fusion, ja usei, tem 3d, da hora |
| 02:19.41 | freebird_2 | jhutchins_lt, well, someone in here told me to |
| 02:19.45 | *** join/#debian jham (~lynucs@fail.fail2fail.com) |
| 02:19.50 | abrotman | freebird_2: english |
| 02:19.54 | freebird_2 | jhutchins_lt,but no success, |
| 02:19.56 | Julius_Brazil | freeb: meu processador é da epoca que usavam 64k de cache então nem exagera, rs rs rs rs |
| 02:19.57 | freebird_2 | abrotman, sorry |
| 02:20.15 | Julius_Brazil | freebird_2, meu processador é da epoca que usavam 64k de cache então nem exagera, rs rs rs rs |
| 02:20.20 | abrotman | Julius_Brazil: ENGLISH |
| 02:20.35 | jhutchins_lt | freebird_2: It usually causes more problems than it solves. it's good for being able to manipulate streams and where they play back, individual volume control per application, other exotic stuff. |
| 02:20.38 | freebird_2 | Julius_Brazil, take a look at vivaoilnux.com.br |
| 02:20.58 | jhutchins_lt | freebird_2: I would suggest removing it. |
| 02:21.08 | *** join/#debian tq (~tobias@cpc12-brig15-2-0-cust154.3-3.cable.virginmedia.com) |
| 02:21.10 | jhutchins_lt | !tell freebird_2 about alsa checklist |
| 02:21.16 | freebird_2 | jhutchins_lt, hmm, I did, and than, it was still there |
| 02:21.16 | *** join/#debian Nu^253r (~LessIsMor@2.176.198.166) |
| 02:21.31 | jhutchins_lt | freebird_2: Check the checklist that dpkg just sent you. |
| 02:21.32 | freebird_2 | jhutchins_lt, and the ssytem gave me a message saying that I had to type autoremove to remove it by complete |
| 02:21.57 | freebird_2 | jhutchins_lt,than, I it started to remove 900mb of things, I stopped, last 10 times this happened, I`ve lost everything |
| 02:22.24 | freebird_2 | and I almost did, now, my windows system, I mean, Gnome, is totally weird, |
| 02:22.36 | *** join/#debian acx0 (~acx0@CPE0014bf4aede6-CM001a668303b2.cpe.net.cable.rogers.com) |
| 02:22.46 | jhutchins_lt | freebird_2: Well, there's more wrong with your system than just the audio problem if that's the case, pulseaudio wouldn't trigger removal of Gnome. |
| 02:22.51 | freebird_2 | and it`s installing like 1gb of thing again, maybe it thinks that everything was removed, and it wasn`t |
| 02:23.00 | *** part/#debian cascardo (~cascardo@187.59.181.92) |
| 02:23.10 | freebird_2 | jhutchins_lt, but asked for a `autoremove` |
| 02:23.13 | freebird_2 | what removes gnome |
| 02:23.19 | *** join/#debian ia (~ia@89.169.161.244) |
| 02:23.30 | *** join/#debian gremset (ubuntu@117.192.105.99) |
| 02:23.32 | freebird_2 | and a hole bunch of things, imagina, 900MB |
| 02:23.49 | jhutchins_lt | freebird_2: Sounds like a reinstall for some reason. |
| 02:24.01 | jhutchins_lt | freebird_2: squeeze? |
| 02:24.04 | freebird_2 | jhutchins_lt,I agree |
| 02:24.17 | freebird_2 | jhutchins_lt,you mean the mail app ? |
| 02:24.31 | jhutchins_lt | freebird_2: No, I mean which release of Debian are you working with? |
| 02:24.36 | freebird_2 | lenny |
| 02:25.08 | freebird_2 | freebird@debian:~$ uname -a |
| 02:25.09 | freebird_2 | Linux debian 2.6.26-2-686 #1 SMP Thu Jan 27 00:28:05 UTC 2011 i686 GNU/Linux |
| 02:25.15 | abrotman | why not squeeze? |
| 02:25.29 | Julius_Fortes | :D |
| 02:25.43 | *** join/#debian linux_inferno (~matt@56.123.91.184.cfl.res.rr.com) |
| 02:25.48 | freebird_2 | abrotman, I thought that this update from lenny to other was automatically, wasn`t it ? |
| 02:25.55 | freebird_2 | isn`t it ? |
| 02:25.57 | jhutchins_lt | freebird_2: If it's newer hardware, moving to squeeze might help. |
| 02:26.02 | abrotman | !tell freebird_2 about lenny->squeeze |
| 02:26.20 | *** join/#debian prefrontal (~prefronta@mist.colorado.edu) |
| 02:27.17 | freebird_2 | jhutchins_lt, not so new, it worked fine for years, but I guess now I`ve no reason to stay with lenny |
| 02:27.30 | *** join/#debian GinTonicool (~bachit@60.186.134.137) |
| 02:28.43 | cretsiah | <PROTECTED> |
| 02:29.08 | buu | Hey, I've got debian installed on a g5 mac box but it's got over heating issues, presumably because the fans aren't being turned on correctly. Anyone have any idea where I can look to turn the fans on? I've tried sensors and sensors-detect and so on.. |
| 02:29.30 | *** join/#debian m4ggus (~marcus@dslc-082-082-142-225.pools.arcor-ip.net) |
| 02:29.55 | rafuch0 | guys by default Where is the log file of sshd in Debian |
| 02:30.15 | rafuch0 | i cant find it in /var/log/secure |
| 02:30.17 | *** join/#debian berend (~user@port165-227.ubs.maxnet.co.nz) |
| 02:30.44 | berend | Does anyone know why apache2 on debian 5 would have 264MB virtual memory? |
| 02:30.49 | berend | doesn't happen on Ubuntu. |
| 02:30.52 | berend | Something special on Debian? |
| 02:31.01 | buu | berend: Same config files? |
| 02:31.13 | berend | out of the box |
| 02:31.18 | *** join/#debian binbrain (~binbrain@ool-43565f5f.dyn.optonline.net) |
| 02:31.20 | berend | I tried both Debian 32/64 bit |
| 02:31.34 | *** join/#debian mick_laptop (~mick@clamwin/admin/mickhome) |
| 02:31.42 | berend | out of the box Debian Apache has 264MB reserved (nothing installed, no php, no other modules). |
| 02:31.50 | berend | used not much real memory obviously. |
| 02:31.53 | *** join/#debian Digdilem (~flash@plague.digdilem.org) |
| 02:32.11 | *** join/#debian guardiola (~Eu@cpj253.neoplus.adsl.tpnet.pl) |
| 02:32.14 | guardiola | is away: Gone away for now |
| 02:32.17 | guardiola | is away: Gone away for now |
| 02:32.31 | *** join/#debian WormFood (~wormfood@58.60.216.141) |
| 02:32.33 | *** join/#debian _Qman (~Q@ip-83-134-207-226.dsl.scarlet.be) |
| 02:32.54 | *** join/#debian behanw (~behanw@gw.intellimec.com) |
| 02:33.12 | *** join/#debian ed1703_ (~ed1703@ultra.edgonline.nl) |
| 02:33.45 | acx0 | is there a DE agnostic configuration file in which you can specify the default program to open specific filetypes with? |
| 02:33.51 | *** join/#debian Dibbler (~Dibbler@87-194-103-72.bethere.co.uk) |
| 02:34.11 | *** join/#debian benebt (~oo@host23.manc-digital.ifl.telecomplete.net) |
| 02:34.22 | *** join/#debian mtx_init (~medex@unaffiliated/medex) |
| 02:34.52 | jhutchins | buu: What have you found out about linux and g5 fans on google? |
| 02:35.07 | jhutchins | buu: Have you actually cleaned out the case and checked to see if they're running or not? |
| 02:35.34 | somiaj | acx0: check out mime-types, and you can use those to define default programs with some wrapper. I know there are some out there |
| 02:35.50 | *** join/#debian pikudoz (~pikudoz@190.235.100.89) |
| 02:35.52 | acx0 | somiaj, okay, thanks |
| 02:35.53 | jhutchins | acx0: Usually the DE is the thing that does that for you, but the alternatives system and mime-type files can do some of it. |
| 02:36.08 | *** join/#debian muneeb (~muneeb@123.237.70.69) |
| 02:37.15 | acx0 | jhutchins, I'm using awesome though, and apparently it doesn't handle this stuff |
| 02:37.42 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 02:38.40 | Connor_ | http://images.4chan.org/g/src/1304907904507.jpg |
| 02:38.44 | Connor_ | What window manager is this? |
| 02:39.37 | rafuch0 | where is the log file off opensshd in debian? |
| 02:39.57 | rafuch0 | /var/log/secure... dont exist |
| 02:40.39 | acx0 | Connor_, look up "tiling window managers", could be xmonad, dwm, wmii, etc |
| 02:41.35 | *** join/#debian mahir256 (~mahir256@50.40.165.17) |
| 02:41.53 | somiaj | rafuch0: what log file do you want? you can see any authencatation in /var/log/auth.log |
| 02:41.55 | *** join/#debian Deadguy (~Deadguy@pdpc/supporter/active/deadguy) |
| 02:42.18 | mahir256 | who maintains the hurd build of debian? |
| 02:42.22 | cretsiah | any opinions on chromium good or bad? |
| 02:42.33 | somiaj | mahir256: check the package, list the matainer |
| 02:42.47 | \amethyst | or could be just screen in a terminal with no wm at all |
| 02:42.49 | somiaj | mariusv: packages.debian.org/hurd (or what ever the pacakge name is) |
| 02:43.08 | somiaj | mahir256: ^^ (sorry mariusv) |
| 02:43.24 | *** join/#debian Fyrespray (~Mark@78.32.255.161) |
| 02:43.27 | rafuch0 | somiaj: thanks i am see in it now |
| 02:43.49 | rafuch0 | what if i incrase the log amonut .... lerts see |
| 02:44.22 | *** join/#debian mrjk (~jezu@194.199.166.96) |
| 02:44.24 | mrjk | Hi |
| 02:44.39 | Connor1 | It's tmux |
| 02:44.58 | mrjk | There is a way to dump the flow of a (S)ATA hardDrive ? |
| 02:45.08 | None2 | Connor1: nice composition. the dolls and wallpaper are eerily contrasting the cubicle. the shining? |
| 02:45.17 | Connor1 | None2 what the fuck are you talking about |
| 02:45.20 | mrjk | like tcpdump, but for I/O of a HD |
| 02:45.23 | Connor1 | Oh |
| 02:45.27 | Connor1 | You should see that guy's whole battlestation |
| 02:45.28 | Connor1 | It's creepy |
| 02:45.39 | mrjk | atadump ? ^^ |
| 02:46.27 | lkthomas | out of topic question, anyone using bugzilla for internal usage ? |
| 02:46.32 | *** part/#debian mahir256 (~mahir256@50.40.165.17) |
| 02:47.18 | *** join/#debian dudz_ (~dudz_@123-243-44-131.static.tpgi.com.au) |
| 02:49.29 | *** join/#debian zz_Cogito (~Cogito@2001:4ba0:fff1:c2::2) |
| 02:49.48 | Cisien | what would i need to do to specify a different config file for an init script? (isc-dhcp-server in this case) |
| 02:50.33 | *** join/#debian elkclone (~patrick@shellium/member/elkclone) |
| 02:50.37 | *** join/#debian chess (~chess@unaffiliated/chess) |
| 02:50.40 | Cisien | can i just give the program's command line args for the config file, or would that be overriden? |
| 02:51.20 | somiaj | Cisien: you could edit the script -- though most applications should have a config file in /etc/ that you can modify to get the options you want |
| 02:51.30 | \amethyst | Cisien: yeah, modify the command line (the start-stop-daemon --start line, or in this case the continuation line that follows) |
| 02:51.52 | Cisien | thats what i thought. how are the default config files defined? |
| 02:51.57 | \amethyst | Cisien: do instead of --exec /usr/sbin/dhcpd -- -q $INTERFACES --exec /usr/sbin/dhcpd -- -q $INTERFACES -cf /etc/my/new/cffile |
| 02:52.01 | *** join/#debian gremset_ (ubuntu@117.192.113.8) |
| 02:52.03 | *** join/#debian sacredchao (debian-tor@gateway/tor-sasl/nike) |
| 02:52.07 | \amethyst | but that depends on the program |
| 02:52.20 | \amethyst | in some cases you can set things like this in /etc/defaults/<program> |
| 02:52.32 | Cisien | right |
| 02:52.51 | \amethyst | but for isc-dhcp-server there isn't any variable you can set there for the config file |
| 02:53.04 | Cisien | yeah |
| 02:54.32 | \amethyst | (in this specific case, because of how INTERFACES is used, you could put -cf foo in INTERFACES but that's very kludgy, hard to understand, and likely to break in a future version of the package |
| 02:54.54 | Cisien | :) |
| 02:55.21 | Cisien | creating a copy of the isc scripts for dhcpv6 |
| 02:56.18 | \amethyst | mrjk: afaik you need a special device for that, since the host doesn't see the on-cable traffic |
| 02:56.54 | \amethyst | as for whether there's a way to see the requests that the kernel has sent to the controller, I don't know but that's more likely anyway |
| 03:01.02 | *** join/#debian Dbug (~Dbug@unaffiliated/dbug) |
| 03:01.39 | *** join/#debian Cisien_ (~chris@chris-pc.cisien.com) |
| 03:02.53 | *** join/#debian dvs (~me@cwv.teksavvy.com) |
| 03:02.58 | *** join/#debian B|ackbird (tanta@unaffiliated/backbird/x-3237639) |
| 03:03.08 | *** part/#debian acx0 (~acx0@CPE0014bf4aede6-CM001a668303b2.cpe.net.cable.rogers.com) |
| 03:03.38 | *** join/#debian guardiola (~Eu@cqf131.neoplus.adsl.tpnet.pl) |
| 03:03.41 | guardiola | is away: Gone away for now |
| 03:03.53 | dvs | !tell guardiola about away |
| 03:04.00 | GinTonicool | No volume control GStreamer plugins and/or devices found. |
| 03:04.11 | GinTonicool | help me ,guys |
| 03:04.19 | CyL | Morning folks, I have just installed Debian on my system, and would like to make it more usable as a dayly use PC (eg, installing codecs, more fonts, java, flash, etc). Are there any good tutorials on this? |
| 03:05.10 | Dewi | XRANDR seems to be broken on vnc4server in squeeze |
| 03:05.19 | Dewi | or just incompatible with current gnome... anyone got any ideas how to fix? |
| 03:06.44 | wols_ | CyL: there are no "codecs" per se for linux |
| 03:06.57 | *** join/#debian Miesco (~mugsy@bas1-kingston08-1096807783.dsl.bell.ca) |
| 03:07.05 | wols_ | CyL: /msg dpkg install java /msg dpkg flash |
| 03:07.50 | CyL | wols_: I remember having installed a codec package while using ubuntu and mint... isn't there such a thing for debian? |
| 03:08.26 | wols_ | you were mistaken. what were these codecs for? |
| 03:08.26 | *** join/#debian Cibort (~Cibort@unaffiliated/cibort) |
| 03:08.33 | Dewi | CyL: debian-multimedia project has more of that stuff than normal debian |
| 03:08.48 | Dewi | CyL: but you're not being very specific about what you need |
| 03:08.52 | bman | what package is GET in? |
| 03:09.02 | Dewi | bman: what's get? |
| 03:09.06 | wols_ | usually, "codecs" are included in the player or framework to show multimedia file(s) |
| 03:09.24 | wols_ | bman: packages.debian.org will know. but I doubt there is a "GET" command in all of debian |
| 03:09.36 | *** join/#debian MadViking (~user@dsl-roibrasgw1-fe8efb00-63.dhcp.inet.fi) |
| 03:09.41 | bman | yes there is |
| 03:09.42 | bman | GET |
| 03:09.48 | bman | /usr/bin/GET |
| 03:09.52 | *** join/#debian doleyb (~pwickis@pool-173-76-249-18.bstnma.fios.verizon.net) |
| 03:09.57 | CyL | Dewi: yeah, I know... it is just that Debian, the way it is, may be great for a server, but it is too bare for normal dayly use on a laptop |
| 03:10.05 | *** join/#debian Selveste1 (~Selveste1@88.83.86.20.static.dong.customer.smilecontent.dk) |
| 03:10.10 | zinx | bman: use apt-file or dpkg -S |
| 03:10.22 | bman | just say no i dont know |
| 03:10.22 | wols_ | bman: I told you: packages.debian.org knows where it is (stupid perl) |
| 03:10.33 | wols_ | bman: we do know. now |
| 03:11.06 | *** join/#debian veebull (~monte@66.172.107.27) |
| 03:11.10 | Dewi | CyL: sure |
| 03:11.13 | wols_ | CyL: any software that is in ubuntu, is available for debian too. maybe except unity and their sysvrc replacement |
| 03:11.26 | Dewi | wols_: and a lot of non-free stuff |
| 03:11.30 | Dewi | wols_: which is why CyL is talking about |
| 03:11.34 | Dewi | s/why/what/ |
| 03:11.35 | zinx | bman: it is generally assumed that typing a single command is not so great a burden that you can't do it, assuming you know the command. because of your question, it was assumed that you didn't. |
| 03:11.51 | bman | well why dont you try to find it that way |
| 03:11.52 | wols_ | Dewi: is that in ubuntu proper? ubuntu being a Free distro? how can that be? |
| 03:11.54 | *** join/#debian Stupendoussteve (~Stevie@pdpc/supporter/student/stupendoussteve) |
| 03:11.54 | *** join/#debian mtx_init (~medex@unaffiliated/medex) |
| 03:11.57 | bman | i tried long before i thought to ask here |
| 03:12.01 | CyL | wols_: I'm not comparing Debian to Ubuntu, I'd just like to know what packages to install... I'm almost sure I installed a (meta)package for this |
| 03:12.02 | zinx | bman: because we are not your personal slaves :/ |
| 03:12.10 | *** join/#debian karl (~kpkarl@unaffiliated/karl) |
| 03:12.12 | zinx | bman: if those commands don't show it, it's not in Debian |
| 03:12.15 | *** join/#debian un214 (~un214@adsl-75-45-20-64.dsl.scrm01.sbcglobal.net) |
| 03:12.20 | bman | thats bs |
| 03:12.24 | zinx | no, it's reality |
| 03:12.28 | wols_ | bman: do you want me a third time to tell how to look for a certain binary in debian? |
| 03:12.29 | bman | no its not |
| 03:12.38 | wols_ | bman: you are simply lazy |
| 03:12.42 | bman | wols give it a try yourselfd |
| 03:12.50 | bman | i already tried through those methods first |
| 03:12.58 | wols_ | bman: I did. and I found it. which is why I now know it's a perl related command |
| 03:13.12 | Dewi | wols_: debian has strict guidelines. ubuntu, not so much |
| 03:13.36 | wols_ | Dewi: well, anything in ubuntu you can find in non-free and dmm, no? |
| 03:13.45 | zinx | wols_: no |
| 03:13.51 | wols_ | zinx: what's missing? |
| 03:13.59 | Dewi | wols_: no. Firefox, mp3 decoders, many non-free drivers |
| 03:14.00 | wols_ | only example. not all of it :) |
| 03:14.18 | Dewi | wols_: a few years ago debian didn't have java or flash |
| 03:14.21 | wols_ | Dewi: dmm has tons of mp3 decoders, non-free has lots of drivers. |
| 03:14.25 | bman | libwww-perl |
| 03:14.26 | wols_ | Dewi: non-free |
| 03:14.35 | CyL | Also, may I use aptitude and apt-get interchanbly, or I must stick to one of them? |
| 03:14.47 | *** join/#debian sombunall (~sombunall@modemcable045.147-22-96.mc.videotron.ca) |
| 03:14.48 | wols_ | CyL: nowadays, interchangeably |
| 03:14.50 | *** join/#debian gremset (ubuntu@117.192.112.55) |
| 03:14.52 | bman | i dunno why i lurk in here at all anymore |
| 03:15.00 | zinx | does apt-get mark automatically installed packages these days? |
| 03:15.03 | Dewi | bman: neither do we |
| 03:15.11 | CyL | wols_: thanks |
| 03:15.23 | zinx | (that, for me, is the main reason to use aptitude instead of apt-get) |
| 03:15.23 | Dewi | bman: we're not a search engine. There are search engines for that |
| 03:15.30 | Dewi | zinx: yes |
| 03:15.31 | rypervenche | CyL: You can use either. I personally use aptitude for most things, apt-get for dist-upgrade |
| 03:15.46 | Dewi | zinx: the only difference now is in dep resolution approaches |
| 03:15.50 | wols_ | bman: and we repeatedly told you which search engine to use |
| 03:15.51 | bman | w/e |
| 03:16.00 | bman | i asked a question |
| 03:16.04 | bman | you didnt answer |
| 03:16.07 | bman | i found it |
| 03:16.09 | bman | sop woo |
| 03:16.12 | zinx | Dewi: ah |
| 03:16.29 | bman | my questions wasnt how to find it, which i already knew |
| 03:16.43 | Dewi | bman: that's laziness, defined |
| 03:16.46 | zinx | bman: if you knew, then you'd know where it is |
| 03:16.48 | bman | simple questions deserve simple answers |
| 03:16.57 | bman | im lazy but you found it and didnt post it |
| 03:17.00 | bman | i did |
| 03:17.09 | bman | so it actually helps someone else as well |
| 03:17.09 | zinx | bman: that, or you're too lazy to type a simple command that would have been shorter than you initial question, and tons shorter than this conversation has been :P |
| 03:17.15 | GinTonicool | No volume control GStreamer plugins and/or devices found. |
| 03:17.18 | None2 | bman: don't you worry. your sense of entitlement will fade. good luck |
| 03:17.24 | wols_ | bman: #debian is not your personal butler. we want people in here help to be able to help themselves. if you need a butler, buy a support contract somewhere |
| 03:17.36 | bman | libwww-perl if you need /usr/bin/GET |
| 03:17.42 | bman | for the search logs |
| 03:17.43 | GinTonicool | No volume control GStreamer plugins and/or devices found. |
| 03:17.43 | GinTonicool | what should i do ? |
| 03:17.49 | zinx | s/you /your / :x |
| 03:17.53 | Dewi | bman: yes, we saw that. I guess we should write it down somewhere. Like in an index, that you refuse to search |
| 03:17.59 | bman | wanders back off until next year when he actually has a question |
| 03:18.31 | Dewi | sigh |
| 03:18.48 | Dewi | I'm the only person in the world trying to use vnc, I guess |
| 03:20.05 | Dewi | !xfce |
| 03:20.06 | dpkg | Xfce is a pretty nifty Desktop Environment. Lightweight, fast, compact. To install, ask me about <install xfce>. Backported 4.6.1 packages for Lenny are available, ask me about <bdo>. http://wiki.debian.org/Xfce http://www.xfce.org/ #xfce on irc.freenode.net. |
| 03:20.13 | *** join/#debian thunderrd (~thunderrd@110.77.242.59) |
| 03:22.06 | *** join/#debian veebull (~monte@66.172.107.27) |
| 03:22.12 | *** join/#debian corretico (~luis@201.201.44.82) |
| 03:22.20 | *** join/#debian veebull_ (~monte@66.172.107.27) |
| 03:23.01 | CyL | well, I have just installed sun-java6-jre, but it looks like iceweasel has not installed the plugin. Is this normal behaviour? |
| 03:23.38 | wols_ | jre is not the plugin afaik |
| 03:23.41 | wols_ | !java plugin |
| 03:23.41 | dpkg | For the Java web browser plugin, install either the free icedtea6-plugin (Squeeze) or icedtea-gcjwebplugin (Lenny) package, or the <non-free> sun-java6-plugin package. For other Java programs, you can install the default-jre package to get a Java runtime; use "apt-cache search java-virtual-machine" to see other implementations. The best options are probably openjdk-6-jre or sun-java6-jre (non-free). See also <java alternatives>. |
| 03:24.02 | wols_ | so sun-java6-plugin it is |
| 03:25.02 | CyL | wols_: I see, I thought that installing the vm, I would also install the plugin, my bad, sorry |
| 03:25.18 | wols_ | no bad at all |
| 03:25.23 | Dewi | can anyone point me to the "proper" way to change a user's default xserver to vnc4server, and default desktop environment to xfce? |
| 03:25.26 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 03:25.50 | wols_ | Dewi: DE you can use .xinitrc |
| 03:26.03 | un214 | doesn't vnc4server need special startup? |
| 03:26.24 | wols_ | I thought so too. maybe .xinitrc too or such. dunno if it was vnc4server or another vnc package tho |
| 03:26.47 | wols_ | startx has an option to select the X server I think. so how do you start your server? |
| 03:26.55 | un214 | I thought vnc4server is launched with arguments including what to start (as if it were xinit itself) |
| 03:26.55 | Dewi | well, vnc4server runs its own script called ~/.vnc/xstartup |
| 03:27.34 | Dewi | oh ffs |
| 03:28.00 | Dewi | xfce factoid installs xorg. annoying. |
| 03:28.12 | *** join/#debian lcafiero (~lcafiero@adsl-99-163-5-114.dsl.pltn13.sbcglobal.net) |
| 03:28.18 | wols_ | Dewi: recommends installs xorg I guess |
| 03:28.35 | wols_ | by default, apt installs recommended packages too which in this case drags in X |
| 03:29.00 | Dewi | argh |
| 03:29.09 | Dewi | purging the same packages didn't remove X |
| 03:29.48 | *** join/#debian ddan (~dan@host194-255-dynamic.6-87-r.retail.telecomitalia.it) |
| 03:29.57 | wols_ | !remove xorg |
| 03:29.57 | dpkg | well, remove x is "aptitude remove x11-common" will remove X. Use "purge" instead of remove if you also want to remove X's configuration. |
| 03:30.47 | Dewi | no, I don't want to remove X clients |
| 03:31.15 | un214 | try xserver-xorg-core |
| 03:31.15 | Dewi | I just don't get how it's installed now since the thing that brought it in is gone |
| 03:33.12 | *** join/#debian susurration (~murmur@unaffiliated/susurration) |
| 03:36.32 | *** join/#debian Rusty1 (~Rusty1@cpe-74-70-70-0.nycap.res.rr.com) |
| 03:36.50 | *** join/#debian Stupendoussteve (~Stevie@pdpc/supporter/student/stupendoussteve) |
| 03:37.22 | *** join/#debian froggyman (~seth@unaffiliated/froggyman) |
| 03:37.25 | *** join/#debian nadar (~nobody@p54B48EA3.dip0.t-ipconnect.de) |
| 03:37.40 | *** join/#debian peterS (~peter@wire.p12n.org) |
| 03:38.00 | *** join/#debian gezgin (~gezgin@81.214.61.147) |
| 03:39.00 | Dewi | ah several overlapping recommends |
| 03:39.29 | Dewi | so is there a way to opt out of just 1 recommends? |
| 03:40.27 | *** join/#debian muddo (debian-tor@gateway/tor-sasl/muddo) |
| 03:41.50 | dvs | Dewi: wouldnt you just pick one solution? |
| 03:42.11 | wols_ | <PROTECTED> |
| 03:42.25 | Dewi | I want recommends on generally |
| 03:42.27 | wols_ | APT::Install-Recommends "false"; |
| 03:42.37 | Dewi | just want it never to install xorg |
| 03:42.39 | wols_ | well, then you can disable it via commandline for that one call |
| 03:42.40 | *** join/#debian elkclone (~patrick@173.180.172.148) |
| 03:42.46 | Dewi | hmm k |
| 03:42.52 | dvs | Dewi: then hold it |
| 03:43.16 | Dewi | dvs: doesn't seem to work on uninstalled packages |
| 03:43.21 | Dewi | dvs: maybe I need to pin it or something? |
| 03:43.30 | un214 | well if you do apt-get remove afterwords |
| 03:43.53 | dvs | has a hold on network-manager and it seems to never install. |
| 03:47.02 | Dewi | even preferences isn't doing it |
| 03:49.31 | *** join/#debian cesurasean (~Sean_Brad@server.simplewebhosting.us) |
| 03:49.40 | Dewi | what includes preferences.d ? |
| 03:49.44 | *** part/#debian berend (~user@port165-227.ubs.maxnet.co.nz) |
| 03:49.45 | Dewi | it seems to do nothing for me |
| 03:49.45 | Rusty1 | would aptitude --without-recommends help ? |
| 03:50.10 | *** join/#debian eledesmar (~eledesmar@201.229.133.233) |
| 03:50.21 | Dewi | Rusty1: sure but 1) I'm happy for other recommends to fire, and 2) I kind of want to prevent it constantly trying to install this every time I manage packages |
| 03:50.57 | *** join/#debian Qtrnx|Tmp (~qtronix@173.84-49-116.nextgentel.com) |
| 03:51.11 | un214 | I have the ability to dummy it up |
| 03:51.31 | un214 | (unfortunately if it's a full depend on any package you just broke your system) |
| 03:51.41 | cesurasean | hey guys, im having trouble with samba server disconnecting me during a large file transfer. if i were to add a 2nd NIC, and bond the two cards together, would that give me a little bit of performance boost so that possibly IF my card is being maxed out, and that's the reason for the dropping connection, it will solve my problems? |
| 03:51.54 | *** join/#debian catsup (d@ps38852.dreamhost.com) |
| 03:52.12 | un214 | ?? |
| 03:52.19 | un214 | it should not drop even if maxed out |
| 03:52.22 | cesurasean | I would really appreciate someone's help with this. I'm banging my head here, and about ready to switch to Windoze. Yes, I said it. |
| 03:52.37 | un214 | it's disconnecting for another reason |
| 03:52.42 | *** join/#debian DimmuR (~DimmuR@unaffiliated/dimmur) |
| 03:52.48 | cesurasean | how do i find out why? |
| 03:52.56 | Dewi | cesurasean: check the logs in /var/log/samba |
| 03:52.56 | cesurasean | when i ping the box, 1 of my requests is dropped, too |
| 03:52.59 | cesurasean | could that be the cause |
| 03:53.06 | cesurasean | Dewi, ive looked in the logs.... |
| 03:53.27 | un214 | really it shouldn't drop even if you have moderate packet drop |
| 03:53.38 | cesurasean | <PROTECTED> |
| 03:53.38 | cesurasean | <PROTECTED> |
| 03:53.39 | Dewi | cesurasean: packet loss is not normal unless your machine is being flooded hugely |
| 03:54.07 | cesurasean | Dewi, my box is under heavy load with this huge transfer. the box seems to be swapping... |
| 03:54.22 | Dewi | cesurasean: a transfer doesn't take much RAM, it should not cause swapping |
| 03:54.23 | *** join/#debian dudz_ (~dudz_@123-243-44-131.static.tpgi.com.au) |
| 03:54.24 | cesurasean | it has no free memory, maybe 14k |
| 03:54.32 | cesurasean | well, it does |
| 03:54.43 | cesurasean | i have 1 gig of ram |
| 03:54.45 | Dewi | cesurasean: can you see in top what process is using the RAM? |
| 03:54.47 | cesurasean | and 14k is free |
| 03:54.50 | cesurasean | yes |
| 03:54.53 | Dewi | cesurasean: free RAM is not really the point |
| 03:54.54 | cesurasean | samba is using all of that |
| 03:54.57 | *** join/#debian Cisien (~chris@2001:470:e883::100) |
| 03:55.05 | Dewi | cesurasean: it's using 1GB? |
| 03:55.09 | cesurasean | yes |
| 03:55.11 | Dewi | cesurasean: then it's badly malfunctioning |
| 03:55.14 | cesurasean | transferring 100GB |
| 03:55.20 | cesurasean | oh? |
| 03:55.31 | cesurasean | i have a squeeze version. should i update it? |
| 03:55.43 | Dewi | is this the client or the server? |
| 03:55.53 | cesurasean | server |
| 03:56.36 | Dewi | try restarting it, monitoring it to see if you can see when it starts to use lots of RAM |
| 03:56.49 | *** join/#debian bloomycat (~user@112.159.93.144) |
| 03:56.53 | *** join/#debian eledesmar (~eledesmar@201.229.133.233) |
| 03:57.33 | *** join/#debian elkclone (~patrick@shellium/member/elkclone) |
| 03:57.43 | *** join/#debian eledesmar (~eledesmar@201.229.133.233) |
| 03:58.24 | *** join/#debian gremset_ (ubuntu@117.192.120.43) |
| 03:59.33 | mrjk | \amethyst: Hey, thanks for your answer, I just check it. |
| 04:00.00 | mrjk | Actually, I think I should write a kernel module to get this famous device |
| 04:00.24 | mrjk | then, I have to create a small program to dump it, like tcpdump I guess |
| 04:00.47 | *** join/#debian cdahmede- (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 04:00.57 | \amethyst | I mean, you need hardware to do it |
| 04:01.01 | *** mode/#debian [+l 1052] by debhelper |
| 04:01.04 | \amethyst | that sits between the controller and the disk |
| 04:01.45 | \amethyst | because all the CPU knows about is what has been sent between the CPU and controller, not necessarily between the controller and the disks |
| 04:01.58 | \amethyst | unless ATA has some snooping features I'm not aware of |
| 04:02.26 | mrjk | \amethyst: hum, so I need a physical probe ? |
| 04:03.26 | cesurasean | Dewi, as soon as the transfer starts, the ram falls. until none is left.. |
| 04:03.34 | Dewi | ah, finally got pinning to work. Turns out you need to say "Pin:" even if you want everything, or it silently skips |
| 04:03.47 | Dewi | cesurasean: stop looking at free RAM, it is meaningless |
| 04:04.06 | Dewi | cesurasean: look at what is used, where |
| 04:04.31 | \amethyst | mrjk: yeah, which could theoretically be a computer with both host-end and target-end connectors, and a kernel module to do forwarding and logging... don't know if that's been implemented, but I saw a thread suggesting it as a possibility (using Marvell's "target mode" support) a few years ago |
| 04:05.07 | cesurasean | samba is using the memory. i told you. |
| 04:05.08 | Dewi | cesurasean: the log should definitely say if the problem was running out of memory tho |
| 04:05.34 | Dewi | cesurasean: which samba process? |
| 04:06.23 | cesurasean | 20422 sbrady 20 0 16248 5676 4644 R 28.6 0.5 26:56.76 smbd |
| 04:06.23 | cesurasean | 20448 sbrady 20 0 15124 3396 2728 R 7.3 0.3 28:26.99 smbd |
| 04:06.47 | Dewi | cesurasean: looks like 8MiB |
| 04:07.07 | Dewi | (up to 31 virtual) |
| 04:07.27 | cesurasean | is that normal? |
| 04:07.36 | *** join/#debian crilly (~Y0momma@cpc7-runc5-2-0-cust132.1-3.cable.virginmedia.com) |
| 04:07.45 | cesurasean | should i just add another NIC to this computer and hope it has more redundancy to make the transfer work? |
| 04:07.55 | cesurasean | i tried adding more ram to no avail |
| 04:08.08 | Dewi | cesurasean: you don't need RAM or multiple NICs to copy a file |
| 04:08.41 | Dewi | cesurasean: is this a LAN? how many machines on it? |
| 04:08.57 | cesurasean | a lan. 2 machines on it. |
| 04:09.05 | cesurasean | i plugged the machine directly to the router, too |
| 04:09.11 | cesurasean | no luck |
| 04:09.14 | cesurasean | bypassed a switch |
| 04:09.27 | cesurasean | it seems the machine is disconnecting for whatever reason. |
| 04:09.30 | Dewi | cesurasean: it kind of sounds like some piece of hardware might be flaky |
| 04:09.53 | Dewi | cesurasean: unless you are generating absolutely stupendous amounts of traffic between 2 machines |
| 04:10.29 | Dewi | cesurasean: what % packet loss do you get pinging? |
| 04:10.39 | cesurasean | im only running drive snapshot for windows onto the share |
| 04:10.57 | cesurasean | Dewi, i don't get much packet loss, but i did notice one request time out |
| 04:11.09 | cesurasean | i assume that time out is causing this |
| 04:11.13 | cesurasean | im going to try to add another nic |
| 04:11.17 | cesurasean | how do i go about bonding NICs? |
| 04:11.32 | cesurasean | perhaps the nic is getting overloadded and skipping a beat. |
| 04:11.47 | *** join/#debian coolmadmax (~cool_code@client-203-166-108-5.net2000.com.au) |
| 04:11.55 | Dewi | cesurasean: you'd be better off swapping out the broken one |
| 04:12.25 | *** join/#debian skrewler (~skrewler@70-36-139-26.dsl.dynamic.sonic.net) |
| 04:12.27 | Dewi | cesurasean: anyway, I don't know how to bond them |
| 04:13.01 | *** join/#debian wipt (~wipt@74-33-91-250.drr01.jrdn.mn.frontiernet.net) |
| 04:13.27 | Dewi | it's not something one generally does unless trying to provide, say, a high bandwidth iSCSI SAN to high-volume servers |
| 04:13.30 | cesurasean | Can someone send me an article on how to bond ethernet cards together? |
| 04:13.34 | *** join/#debian Old_Spike0 (~Old_Spike@82.158.227.59.dyn.user.ono.com) |
| 04:13.35 | wipt | this might sound like a dumb question - I googled around.... How do I change the volume? |
| 04:14.00 | Dewi | wipt: depends. Are you in gnome? |
| 04:14.08 | wipt | Dewi: cli |
| 04:14.11 | *** join/#debian hardnrgg (~roycable@124-170-21-bcast.dyn.iinet.net.au) |
| 04:14.36 | Dewi | wipt: your audio subsystem should have a CLI volume app somewhere |
| 04:14.51 | Dewi | wipt: I don't actually know which one is default nowadays |
| 04:15.03 | *** join/#debian cahoot (~radix@c83-252-75-32.bredband.comhem.se) |
| 04:15.03 | *** join/#debian cahoot (~radix@pdpc/supporter/active/cahoot) |
| 04:15.05 | wipt | I installed aumix, and cmus. cmus plays music back fine, with oss I think |
| 04:15.24 | wipt | aumix just says it can't find/open the audio device |
| 04:15.48 | wipt | I've looked around in /dev a little, but I'm a FreeBSD guy :P |
| 04:15.54 | Old_Spike0 | wipt: try alsamixer. |
| 04:16.34 | *** join/#debian gn00b (~gn00b@71-223-197-222.phnx.qwest.net) |
| 04:16.35 | *** join/#debian jonsu (~jon@c-24-13-62-154.hsd1.il.comcast.net) |
| 04:17.05 | jonsu | guys iv been RTFMing for a while now |
| 04:17.18 | jonsu | my fing debian hosting server is under attack by a hacker |
| 04:17.30 | jonsu | irc spam botnet type of deal |
| 04:17.58 | jonsu | i stopped perl wget and other critical procceses this fuck is exploditing a phpBB loophole in one of the sites we host |
| 04:18.12 | *** join/#debian waka (~waka@unaffiliated/waka) |
| 04:18.16 | jonsu | now the attacker is gaining priveglages somehow |
| 04:18.27 | jonsu | and locking the ports preventing me from sshing in |
| 04:18.40 | jonsu | we have iptables installed so does anyone have any idea how he could be blocking my ssh port |
| 04:18.42 | jonsu | other than iptables |
| 04:19.50 | un214 | try tcptraceroute first |
| 04:19.57 | wipt | jonsu: he could have moved or secured the port in several ways? |
| 04:20.38 | jonsu | i know i just started a new job |
| 04:20.39 | *** join/#debian Gilde (~Gilde@dslb-092-076-130-254.pools.arcor-ip.net) |
| 04:20.46 | jonsu | and our hosting server is completly comprimised |
| 04:20.59 | jonsu | and no one has done anything about it just delte the temp files |
| 04:21.08 | jonsu | twenty times a day |
| 04:21.09 | *** join/#debian freebird_2 (~freebird@189.62.55.25) |
| 04:21.14 | un214 | if I were you I'd wipe & rebuild asap |
| 04:21.20 | jonsu | yup |
| 04:21.28 | jonsu | im becoming more and more convinced a compelte pave |
| 04:21.30 | jonsu | is whats needed |
| 04:21.51 | un214 | the modern trojans are too hard to remove |
| 04:22.04 | jonsu | their really nasty |
| 04:22.17 | jonsu | the attacks came in a vareity of form stoo |
| 04:22.17 | jonsu | first it was a nasty perl script |
| 04:22.20 | jonsu | using tcp courrier |
| 04:22.31 | jonsu | so the attacker was basically |
| 04:22.35 | jonsu | using an irc channel |
| 04:22.50 | jonsu | as an effective shell |
| 04:23.03 | jonsu | to the remote hosts connected to |
| 04:23.03 | jonsu | the channel |
| 04:23.03 | jonsu | i traced the ip to the actual channel |
| 04:23.11 | jonsu | and typed in some changes |
| 04:23.16 | jonsu | and saw them refelcted on the host machine |
| 04:23.29 | jonsu | they dont have root privelges so I was able to stop a lot of stuff |
| 04:23.32 | *** join/#debian elninja (~r@c-76-23-71-22.hsd1.in.comcast.net) |
| 04:23.36 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 04:23.43 | jonsu | but every time I stop another hole |
| 04:23.48 | jonsu | they do something else |
| 04:23.52 | jonsu | tell me this |
| 04:23.56 | jonsu | when you use the top comand |
| 04:24.02 | *** join/#debian Agiofws (~Agiofws@athedsl-421136.home.otenet.gr) |
| 04:24.04 | jonsu | are their ways to hide processes from being in that list |
| 04:24.15 | *** join/#debian Soul_Eater (~marcelo@187.127.127.156) |
| 04:24.15 | *** join/#debian Soul_Eater (~marcelo@unaffiliated/soul-eater/x-4649632) |
| 04:24.30 | un214 | no root privs eh |
| 04:24.35 | un214 | that makes purge a lot easier |
| 04:24.50 | un214 | not without root |
| 04:24.56 | jonsu | yea they havent cracked the root pword |
| 04:25.00 | jonsu | but i use wireshark |
| 04:25.03 | jonsu | and tial the secure logs |
| 04:25.05 | jonsu | and they are trying |
| 04:25.14 | *** join/#debian pierrep (~pierrep@bas2-montreal42-1096690732.dsl.bell.ca) |
| 04:25.25 | un214 | fyi I'd immediately enable public key for root and disable root password |
| 04:25.52 | un214 | without root they can't hide from ps |
| 04:25.52 | *** join/#debian Nutterpc (~Nutterpc@1.144.59.255) |
| 04:26.00 | jonsu | got it |
| 04:26.02 | un214 | but they can hide their trojan within any process by same user |
| 04:26.09 | jonsu | does public key work just like how it does in the GIT? |
| 04:26.17 | jonsu | openssh type shit? |
| 04:26.23 | un214 | yes |
| 04:26.42 | jonsu | the attacker was using qmail to send spam |
| 04:26.46 | *** join/#debian iRabbit (iRabbit@c-69-245-206-152.hsd1.il.comcast.net) |
| 04:26.48 | jonsu | and our host was gonan shut us down |
| 04:26.54 | jonsu | so i just made it so only root could use |
| 04:26.55 | jonsu | wget |
| 04:26.57 | jonsu | perl |
| 04:27.01 | jonsu | etc... |
| 04:27.15 | tuv | what's your take on init replacements? e.g. runit, upstart, etc |
| 04:27.23 | kgoetz | um, why not close their account and kill thier processes? |
| 04:27.37 | un214 | because he's getting in somehow else |
| 04:27.41 | jonsu | yup |
| 04:27.44 | jonsu | man it goes like this |
| 04:27.52 | jonsu | i got all the processes done |
| 04:27.54 | jonsu | no more spam |
| 04:27.56 | jonsu | they cant send shit |
| 04:27.57 | jonsu | but |
| 04:28.14 | jonsu | they are flooding my tmp directory |
| 04:28.15 | jonsu | and plugging SSH |
| 04:28.15 | jonsu | just to be cocks |
| 04:28.24 | jonsu | also |
| 04:28.30 | jonsu | they are getting in thru a php vulernability |
| 04:28.33 | jonsu | so the username is apache |
| 04:28.46 | jonsu | so i cant just delete apache |
| 04:29.02 | kgoetz | jonsu: you can shut it down though |
| 04:29.05 | kgoetz | and kill off php] |
| 04:29.46 | un214 | have you found the exploit in your logs yet |
| 04:29.48 | jonsu | i know but we need the PHP to run for all the other damn client websites we got on the host |
| 04:29.57 | *** join/#debian jpablobr (~xjpablobr@59.86.160.46) |
| 04:30.17 | jonsu | yes |
| 04:30.29 | jonsu | this produce called OScomerce shopping cart |
| 04:30.37 | jonsu | in one of the porn sites that we host |
| 04:30.39 | jonsu | in the images folder |
| 04:30.46 | jonsu | i found an apache cron tab |
| 04:30.47 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 04:30.57 | un214 | hmmm |
| 04:31.00 | jonsu | pointed thier that was running hte original trojan |
| 04:31.00 | jonsu | which was a nasty zip file that unizpped tons of othe rones |
| 04:31.01 | un214 | apache cron tab |
| 04:31.03 | jonsu | all over the system |
| 04:31.06 | jonsu | yup |
| 04:31.08 | jonsu | i went |
| 04:31.12 | un214 | delete it and create a directry by that name |
| 04:31.15 | jonsu | crontab -e -u apache |
| 04:31.44 | jonsu | where would i create the directory? |
| 04:32.38 | un214 | /var/spool/cron/crontabs |
| 04:33.02 | jonsu | nice |
| 04:33.13 | jonsu | so is the idea if root creates a directory |
| 04:33.20 | jonsu | then if the apache trys to make an entry |
| 04:33.30 | jonsu | they would have to modify the roots creation and could not do that bc of permissions |
| 04:33.58 | un214 | the crontab file is /var/spool/cron/crontabs/apache |
| 04:34.10 | un214 | crontab command creates it (cron is suid root) |
| 04:34.19 | un214 | but if there's a directory there crontab can't create it |
| 04:34.37 | jonsu | nice |
| 04:34.55 | *** join/#debian veebull (~monte@66.172.107.27) |
| 04:35.06 | jonsu | i used rkhunter |
| 04:35.08 | jonsu | and chkrootkit |
| 04:35.11 | jonsu | and no signs of root kits |
| 04:35.34 | jonsu | thanks for the info un |
| 04:35.40 | jonsu | i'll def put that in place |
| 04:35.49 | un214 | there can't be a root kit |
| 04:35.52 | un214 | they don't have root |
| 04:36.03 | un214 | but you need to locate the exploit itself |
| 04:36.20 | jonsu | i just cant figure out |
| 04:36.23 | jonsu | how hes loading the files on |
| 04:36.25 | jonsu | without wget |
| 04:36.38 | jonsu | im trying to track it down |
| 04:36.43 | CompWizrd | curl, scp, rsync, there's many ways |
| 04:36.53 | un214 | he probably has an executable code exploit |
| 04:37.12 | jonsu | yup it revovles around uploading an image |
| 04:37.15 | jonsu | thats excutable |
| 04:37.16 | un214 | what's to stop him from including his own download utility in the exploit |
| 04:37.27 | *** join/#debian zeroedout (~quassel@S01060080c6fcfaab.vc.shawcable.net) |
| 04:38.23 | jonsu | thats true he probobly has all kinds of stuff on their |
| 04:38.28 | jonsu | it seems randomly |
| 04:38.34 | jonsu | all ssh connections will terminate |
| 04:38.39 | jonsu | and the attacker plugs up the ports |
| 04:38.44 | jonsu | and the connections get refused |
| 04:38.48 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 04:39.00 | CompWizrd | for your next install, fail2ban or similar might be a good idea to look into |
| 04:39.00 | un214 | nasty |
| 04:39.01 | *** join/#debian mquin (~mquin@freenode/staff/mquin) |
| 04:39.08 | un214 | won't help |
| 04:39.19 | un214 | it's probably coming from localhost |
| 04:39.32 | jonsu | yup it is he is binding |
| 04:39.34 | jonsu | the ssh port |
| 04:39.37 | jonsu | to the local host |
| 04:39.44 | jonsu | or iv seen |
| 04:39.46 | jonsu | 0.0.0.0 |
| 04:39.58 | CompWizrd | what's your sysadmin said about this? |
| 04:40.02 | CompWizrd | or your security admin |
| 04:40.06 | un214 | what |
| 04:40.10 | jonsu | unfortunently |
| 04:40.14 | jonsu | i just got on the scene |
| 04:40.17 | un214 | if he can bind his own program to 22 he's got root |
| 04:40.24 | jonsu | ok |
| 04:40.31 | jonsu | bc |
| 04:40.32 | un214 | wait a minute |
| 04:40.38 | un214 | you ran netstan -anp | grep 22 |
| 04:41.11 | jonsu | not yet |
| 04:41.21 | jonsu | im waiting for the server to become sshable |
| 04:41.29 | jonsu | i have to wait for the hosting company to restart it |
| 04:41.32 | *** join/#debian paquin (~paquin@2001:470:26:4e::dead:feed) |
| 04:41.33 | jonsu | usually happens in the morning |
| 04:41.39 | un214 | gonna need console now |
| 04:41.39 | jonsu | yea their is no system admin |
| 04:41.43 | jonsu | the code standrd suck |
| 04:41.52 | un214 | this guy's being downright nasty |
| 04:41.57 | wipt | >.< |
| 04:42.08 | un214 | get some hex dice and hide a second sshd on a random port |
| 04:42.16 | jonsu | thats what i was thinking |
| 04:42.19 | jonsu | if i edit the ssh conf |
| 04:42.20 | un214 | oh, and firewall it off from all ip ranges but yours |
| 04:42.23 | jonsu | and add another port in |
| 04:42.25 | un214 | so he can't portscan for it |
| 04:42.37 | jonsu | will the attacker be able to easily find out |
| 04:42.42 | jonsu | which additional ssh port i added |
| 04:42.44 | un214 | and change /etc/ssh/sshd.conf to be mode 600 |
| 04:42.48 | jonsu | and block it off int he next iteariton of atacks |
| 04:42.53 | jonsu | ok |
| 04:42.54 | un214 | eventually |
| 04:43.04 | jonsu | hehe yup process of elimination |
| 04:43.14 | jonsu | any idea of how high you can amke a port number? |
| 04:43.20 | un214 | 65535 |
| 04:43.25 | jonsu | ahh |
| 04:43.29 | jonsu | what a magic number |
| 04:43.36 | un214 | 2^16 - 1 |
| 04:43.41 | jonsu | :) |
| 04:44.04 | jonsu | beutiful |
| 04:44.16 | un214 | well if you want you can attack his control center |
| 04:44.17 | *** join/#debian amore23 (~chatzilla@99-104-149-74.lightspeed.sndgca.sbcglobal.net) |
| 04:44.21 | *** join/#debian abchirk_ (~abchirk@g225109177.adsl.alicedsl.de) |
| 04:44.32 | jonsu | man iv been finding them |
| 04:44.34 | jonsu | all over |
| 04:44.34 | *** part/#debian amore23 (~chatzilla@99-104-149-74.lightspeed.sndgca.sbcglobal.net) |
| 04:44.39 | jonsu | its like they keep appearing everywhere |
| 04:44.43 | un214 | of course |
| 04:44.44 | jonsu | everytime i delte one |
| 04:44.50 | jonsu | the attacker gets all mad |
| 04:44.53 | un214 | next time don't delete one |
| 04:44.53 | jonsu | plugs the ports |
| 04:44.57 | jonsu | reinstalls |
| 04:45.03 | un214 | repeatedly nmap the next one you find |
| 04:45.10 | jonsu | ok |
| 04:45.19 | jonsu | i mean i know what ip address he is using |
| 04:45.21 | wipt | would turning off writing to /usr help? |
| 04:45.33 | un214 | how's he writing to /usr? |
| 04:45.34 | *** join/#debian guardiola (~Eu@cqf131.neoplus.adsl.tpnet.pl) |
| 04:45.39 | *** join/#debian Tigger__ (~Tigger__@cpc4-fare6-2-0-cust436.6-1.cable.virginmedia.com) |
| 04:45.55 | jonsu | i traced the ip address down |
| 04:46.02 | jonsu | its fucked up you go into this irc channel |
| 04:46.13 | jonsu | and i used the login in the script i found |
| 04:46.14 | un214 | what's IP |
| 04:46.16 | jonsu | and its a whole botnet |
| 04:46.26 | jonsu | and the ip changes |
| 04:46.30 | jonsu | a lot |
| 04:46.34 | jonsu | i got like 20 diff ips |
| 04:46.38 | jonsu | bc the same thing |
| 04:46.41 | jonsu | trys to bust my root |
| 04:46.45 | jonsu | i see like |
| 04:46.48 | jonsu | uname: ameila |
| 04:46.51 | jonsu | pword: dick |
| 04:46.53 | jonsu | uname: ameila |
| 04:46.58 | jonsu | p;word: dickin |
| 04:47.22 | jonsu | once i can login again |
| 04:47.24 | jonsu | i can share |
| 04:47.27 | jonsu | but it was really freaky |
| 04:47.31 | jonsu | when you type in the hcannel |
| 04:47.32 | jonsu | like |
| 04:47.34 | jonsu | i typed |
| 04:47.34 | jonsu | ls |
| 04:47.35 | un214 | I don't need to log in |
| 04:47.42 | jonsu | and |
| 04:47.44 | CompWizrd | ok.. can you NOT lean on the enter key every couple words? |
| 04:48.16 | un214 | and it ran ls on your server |
| 04:48.41 | un214 | and lots of others right |
| 04:48.44 | jonsu | yes it listed the contents on my server and the hackers bot is called "terobot" |
| 04:48.59 | *** join/#debian ShapeShifter499 (~ShapeShif@c-98-208-108-89.hsd1.ca.comcast.net) |
| 04:49.27 | jonsu | yup |
| 04:49.36 | un214 | next time you get in do kill -9 -1 |
| 04:49.46 | un214 | the guy might leave you alone after that |
| 04:50.23 | jonsu | i was tempted to wipe out his bots but I was worried if I removed everything i might wipe out my server too |
| 04:50.26 | un214 | (that will crash every server he's compromized) |
| 04:50.48 | un214 | that's the general idea |
| 04:50.57 | jonsu | duely noted... sorry comp wizrd i will restrain the enter key but this subject has got me pretty heated |
| 04:51.24 | un214 | you can rebuild if it crashes |
| 04:51.37 | un214 | he'll have to retake all of his |
| 04:51.37 | jonsu | thanks for the advice. do you got any suggestions for what logs I could read to tell me useful informatin that I could come back here with? |
| 04:51.56 | un214 | oh and block port 6667 |
| 04:51.59 | jonsu | ok |
| 04:52.00 | un214 | outbound |
| 04:52.36 | un214 | that will force him to try another c&c method |
| 04:53.19 | jonsu | thats good advice I can make him have to redo all his cracks on all the boxes hes comprimised |
| 04:53.41 | un214 | the general idea is to make him think you're too much of a pest to bother with |
| 04:53.50 | CompWizrd | i'd be careful of screwing around with machines you don't own.. running commands on someone elses machines can run afowl of federal laws |
| 04:54.19 | *** join/#debian guardiola (~Eu@cqf131.neoplus.adsl.tpnet.pl) |
| 04:54.32 | CompWizrd | and consider that whoever is running this botnet probably knows what they're doing a lot better than you do.. and a human stands out in a control channel.. they might follow you home. |
| 04:54.45 | un214 | that's already known |
| 04:54.47 | CompWizrd | and then you're fixing more than one server |
| 04:56.02 | jonsu | good point thats why I told my guys in the beginning to stay out of that channel |
| 04:56.31 | jonsu | honestly it freaked me out that an attacker could control numerous machiens thru IRC and infect linux networks |
| 04:56.34 | un214 | I'd rather join if I could |
| 04:56.42 | *** join/#debian jhford (~jhford@johnford.info) |
| 04:56.49 | un214 | he'll never get onto my network |
| 04:58.02 | *** join/#debian Tigger__ (Tigger@cpc4-fare6-2-0-cust436.6-1.cable.virginmedia.com) |
| 04:59.12 | jonsu | good points by all thank you for all your help. I'll make an additional ssh port and chmod the ssh conf file |
| 04:59.42 | *** join/#debian stoffell (~stoffell@d54C185A4.access.telenet.be) |
| 04:59.57 | *** join/#debian moniker326 (~moniker32@c-71-56-135-99.hsd1.wa.comcast.net) |
| 04:59.59 | *** join/#debian slvmchn (~slvmecha@c-24-91-117-140.hsd1.ma.comcast.net) |
| 05:01.01 | *** mode/#debian [+l 1043] by debhelper |
| 05:04.28 | *** join/#debian manio (~mariusz@87-206-100-87.dynamic.chello.pl) |
| 05:05.06 | *** join/#debian pLr (~acer@unaffiliated/plr) |
| 05:05.32 | *** join/#debian moniker326 (~moniker32@c-71-56-135-99.hsd1.wa.comcast.net) |
| 05:05.41 | *** join/#debian WormFood (~wormfood@58.60.216.141) |
| 05:06.08 | *** join/#debian Tigger__ (~Tigger__@cpc4-fare6-2-0-cust436.6-1.cable.virginmedia.com) |
| 05:07.47 | *** join/#debian cdahmede- (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 05:12.31 | *** join/#debian moty66 (~chatzilla@host144-202-static.24-87-b.business.telecomitalia.it) |
| 05:13.36 | *** join/#debian MrOpposite (~mropposit@unaffiliated/mropposite) |
| 05:14.13 | guardiola | is away: Gone away for now |
| 05:15.15 | kgoetz | guardiola: *turn it off* |
| 05:15.34 | *** join/#debian Fyrespray (~Mark@78.32.255.161) |
| 05:16.47 | *** join/#debian DimmuR (~DimmuR@unaffiliated/dimmur) |
| 05:18.21 | Dewi | does xfce have a log file? |
| 05:19.06 | pLr | Dewi: yes |
| 05:20.11 | *** join/#debian Fyrespray^ (~Mark@78.32.255.161) |
| 05:20.53 | *** join/#debian zack (~zack@h37.163.23.98.static.ip.windstream.net) |
| 05:20.59 | Dewi | pLr: any idea where? or is it something I need to enable? |
| 05:21.00 | *** mode/#debian [+l 1037] by debhelper |
| 05:21.47 | *** join/#debian muddo (debian-tor@gateway/tor-sasl/muddo) |
| 05:23.03 | *** join/#debian afurlan (~afurlan@177.16.186.111) |
| 05:23.35 | *** join/#debian Jordan_U (~jordan@216.57.70.194) |
| 05:23.41 | *** join/#debian SSL` (~Unix@nat/hp/x-sjrpqlceybzmjmji) |
| 05:25.35 | *** join/#debian Fyre (~Mark@78.32.255.161) |
| 05:27.07 | zack | I installed some packages from debian-multimedia, and now vlc's video seems to be completely broken. How could I either further diagnose the problem or uninstall any packages I got from that repository? |
| 05:27.40 | zack | actually I did a dist-upgrade after adding the debian-multimedia repository and a few packages were auto-selected |
| 05:27.51 | *** join/#debian Guest21814 (~ari@180.246.142.134) |
| 05:27.51 | zack | I did it with aptitude, so it should be relatively easy to remove, right? |
| 05:28.15 | Dewi | zack: look up the aptitude search operators in its manual |
| 05:28.30 | Dewi | zack: /usr/share/doc/aptitude/README |
| 05:30.48 | *** join/#debian dudz_ (~dudz_@123-243-44-131.static.tpgi.com.au) |
| 05:33.39 | zack | Dewi: it looks like ?maintainer will work perfectly: any pointers on uninstalling packages that match that pattern? |
| 05:33.57 | *** join/#debian githogori (~githogori@adsl-66-123-22-146.dsl.snfc21.pacbell.net) |
| 05:34.06 | *** join/#debian Kilhd (Kilhd@207.98.210.144) |
| 05:35.16 | Dewi | zack: if remove or purge don't accept a pattern, just search first and copy the list of packages |
| 05:35.47 | zack | Dewi: ok |
| 05:35.50 | *** part/#debian ohwow (mao@meine.xn--nck9azb.jp) |
| 05:36.13 | Dewi | zack: remove/purge should accept search patterns tho, there are examples on the man page |
| 05:36.19 | Guest21814 | dewi : how to install and configure NTP Server at debian 5 ? |
| 05:36.30 | *** join/#debian doleyb (~pwickis@pool-173-76-249-18.bstnma.fios.verizon.net) |
| 05:36.33 | zack | Dewi: I guess removing isn't going to be an option because it seems to cause tons of dependency problems |
| 05:36.55 | zack | I have the list of packages: is it possible to revert them all back to the official versions? |
| 05:37.34 | *** join/#debian ElDiabolo (~jo@2.210.29.173) |
| 05:37.43 | Dewi | zack: apt doesn't support downgrade. Removing new packages should work, but it sounds like you have some upgrades mixed in there too |
| 05:38.03 | zack | Dewi: probably |
| 05:38.11 | Kilhd | Hi, if I want to install debian 6 from DVD with gnome as windows manger, do I only need the DVD1 iso or would I need the others? |
| 05:38.24 | zack | Dewi: could I remove those packages, ignoring dependencies, and then try to repair the dependencies without that repository enabled? |
| 05:38.25 | Dewi | zack: I can't think of any quick way to sort that out, you probably need to go through the list manually |
| 05:38.39 | r21 | how to install and configure NTP Server at debian 5 ? |
| 05:39.37 | Dewi | zack: maybe. Risky though. If you try it, probably best to purge to get rid of all remnants |
| 05:40.01 | Dewi | r21: install ntp package |
| 05:40.23 | Dewi | r21: apt-get install ntp |
| 05:41.04 | *** join/#debian simonlnu (simon@unaffiliated/simonrvn) |
| 05:41.07 | Dewi | does debian contain any xrandr applets that work with 1.1 anymore? |
| 05:41.20 | Dewi | lenny did... can't find any for squeeze |
| 05:42.40 | *** join/#debian _Qman (~Q@mail.dnavision.be) |
| 05:42.46 | *** join/#debian Zeit|awy (~wurscht@HSI-KBW-109-193-077-147.hsi7.kabel-badenwuerttemberg.de) |
| 05:44.07 | zack | Dewi: I can't seem to make it actually ignore the dependencies |
| 05:44.42 | zack | Dewi: I was trying apt-get --ignore-missing but that doesn't seem to do what i want |
| 05:44.49 | Dewi | zack: why don't you just try removing the stuff that's easy to remove and see if that fixes your problem? |
| 05:45.13 | Dewi | zack: you probably need at least --force to break the package deps |
| 05:45.24 | streuner | Kilhd: yes, /msg dpkg gnome install (if you have a working i-net connection) then |
| 05:45.29 | *** join/#debian deadlyninja (~tim@ip70-190-167-250.ph.ph.cox.net) |
| 05:46.12 | streuner | Kilhd: but, basically you install Debian via netinstall (/msg dpkg netinstall) |
| 05:46.36 | deadlyninja | how can i tell which architecture my debian box is running? |
| 05:47.13 | red2kic | deadlyninja: "uname -m" |
| 05:47.21 | zack | Dewi: I think the acutal culprit is probably packages like libdrm and libva that were retrieved from that repository |
| 05:47.23 | *** join/#debian coax (coax@zephyr.darklord.net) |
| 05:47.36 | streuner | dpkg, what's my architecture |
| 05:47.37 | dpkg | dpkg --print-architecture |
| 05:47.58 | deadlyninja | streuner, thanks |
| 05:48.12 | zack | Dewi: I'm not sure how to install the official version without removing it, but doing so breaks X11 |
| 05:48.20 | deadlyninja | ok, my architecture is arm, which was discontinued in v6.0, can i upgrade to armel? |
| 05:48.37 | deadlyninja | do i have to do a complete reinstall to switch to armel from arm? |
| 05:48.45 | deadlyninja | err, strike that, reverse it |
| 05:48.45 | zack | Dewi: E: Command line option --force is not understood |
| 05:48.54 | deadlyninja | oh nm, that was right |
| 05:50.21 | zack | Dewi: the other problem is removing things like libavcodec52 ends up making apt want to remove the gnome metapackage which then makes most of the system want to uninstall |
| 05:50.54 | *** join/#debian return13 (~return13@ux-2800.inf.fh-bonn-rhein-sieg.de) |
| 05:50.55 | *** join/#debian Roma_39m (~mirc@93-40-96-5.ip38.fastwebnet.it) |
| 05:51.28 | Kilhd | streuner: Thanks |
| 05:51.31 | *** join/#debian ElDiabolo (~jo@2.210.29.173) |
| 05:53.34 | johndo | zack: you can try to remove the multimedia archive from sources.list, set priority of the standard repository to a value above 1000 which allows downgrade and then run an aptitude update and upgrade |
| 05:54.03 | *** join/#debian Judas_PhD (~kevin@misterfluffy.dsl.xmission.com) |
| 05:54.11 | johndo | but check carefully what aptitude likes to do then ;) |
| 05:54.45 | Dewi | johndo: nice one |
| 05:55.47 | Dewi | downgrade is of course not really supported, but if you're lucky there won't be much config state breakage |
| 05:55.56 | *** join/#debian linux_probe (~chris@cpe-184-56-117-183.neo.res.rr.com) |
| 05:56.11 | deadlyninja | i have an 'arm' architecture device, squeeze only supports 'armel' now is there any way to upgrade or do i need to reinstall? |
| 05:57.04 | simonlnu | 'armel' is little endian arm |
| 05:57.30 | deadlyninja | dont arm devices support running in both little endian and big endian? |
| 05:57.53 | niklaswe | morning |
| 05:58.24 | streuner | #debian-arm 44 http://wiki.debian.org/ArmPort | http://wiki.debian.org/ArmHardFloatPort |
| 05:58.25 | streuner | * End of /LIS |
| 05:58.35 | streuner | (that's OFTC) |
| 05:58.38 | simonlnu | i heard something like that. unfortunately i don't recall if that's all of them or not. |
| 05:59.29 | zack | johndo: that seems to be working |
| 06:00.37 | zack | johndo: brilliant, thank you, vlc is working again |
| 06:02.39 | *** join/#debian nviror (~navi@122.162.73.48) |
| 06:02.43 | streuner | deadlyninja: http://www.debian.org/releases/squeeze/armel/release-notes/ |
| 06:02.48 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 06:03.24 | streuner | deadlyninja: here -> http://www.debian.org/releases/squeeze/armel/release-notes/ch-upgrading.en.html |
| 06:04.00 | zack | johndo: why not make that a downgrade action in apt? |
| 06:04.13 | zack | johndo: it makes sense and seems to work |
| 06:04.51 | deadlyninja | streuner, i followed that upgrade guide already, but it fails the apt-get update because the architecture 'arm' no longer exists on the server |
| 06:05.20 | *** join/#debian Auron (~auron@61.152.132.103) |
| 06:05.29 | deadlyninja | streuner, the cpu is capable of running the armel branch, but it looks like i might just have to reinstall since its like going from x86 to amd64 |
| 06:05.43 | streuner | deadlyninja: ok, just /j #debian-arm on OFTC, sorry but i have no idea about arm/armel at all. |
| 06:06.46 | simonlnu | yeh, your user and kernelspace is probably totally wrong now - in relation to debian's idea of it |
| 06:07.12 | *** join/#debian zezib (~IceChat77@modemcable004.103-81-70.mc.videotron.ca) |
| 06:07.14 | deadlyninja | streuner, im there now, thanks |
| 06:08.16 | *** join/#debian chelz (~iridesenc@unaffiliated/chelz) |
| 06:08.26 | *** join/#debian bman__ (~bman@sat-69-171-166-251.evdo.leapwireless.net) |
| 06:08.58 | chelz | say i was going to setup my server to email me when various things happen. what are good things to do that for, besides software/apt updates? |
| 06:10.32 | *** join/#debian on1ald (~ben@178-118-136-88.access.telenet.be) |
| 06:11.53 | *** join/#debian elkclone (~patrick@173.180.172.148) |
| 06:11.53 | johndo | zack: apt or aptitude doesn't matter, both should work the same, use what you prefer |
| 06:12.08 | streuner | !nagios |
| 06:12.08 | dpkg | Nagios (formerly NetSaint) is a popular open source computer system and network monitoring application software. It watches hosts and services that you specify, alerting you when things go bad and again when they get better. Packaged for Debian as nagios3. http://wiki.debian.org/PkgNagios http://www.nagios.org/faqs/ #nagios on irc.freenode.net. |
| 06:12.17 | johndo | i use aptitude as it seem to be smarter in resolving dependencies sometimes |
| 06:12.22 | jmarsden | chelz: low disk space, high temp, fans not spinning, high cpu load for a long time ... etc etc. |
| 06:12.56 | *** part/#debian Gryllida (user@pdpc/student/wikinews.Gryllida) |
| 06:12.56 | aspect | !monit |
| 06:12.56 | dpkg | Monit is a utility for monitoring services on a UNIX system, performing actions (e.g. service restart via init script) when issues are detected. http://mmonit.com/wiki/Monit/FAQ http://www.debian-administration.org/articles/269 http://mmonit.com/monit/ See also <nagios>. |
| 06:13.29 | aspect | nagios is pretty but probably a bit of overkill for monitoring one box |
| 06:13.36 | chelz | oh yeah i heard about monit |
| 06:13.38 | chelz | ah |
| 06:13.41 | jmarsden | Easy on the factiods, guys... the question was what is worth checking for and emailing alerts for, not what software to use :) |
| 06:14.08 | aspect | jmarsden: eep! :) |
| 06:14.22 | chelz | well whatever they monitor for might be good to have in some kind of summary email thing. but yeah, in terms of like alert items i should have forwarded to my phone i guess is my primary question |
| 06:15.18 | *** join/#debian harpal (~Harpal@122.169.108.196) |
| 06:15.22 | *** join/#debian elkclone (~patrick@shellium/member/elkclone) |
| 06:15.30 | *** join/#debian mshindo (~mshindo@203-114-166-191.dsl.sta.inspire.net.nz) |
| 06:17.02 | zack | johndo: I was suggesting a conveinient "downgrade" action for apt/aptitude that worked similar to how this apt-pinning mechanism works |
| 06:17.08 | *** join/#debian dekar_ (~dekar@drms-590c5eee.pool.mediaWays.net) |
| 06:17.15 | Bushmills | chelz: i like emails when load is high for a minimum period, when disks fill up above a set limit, and when traffic has been above a certain margin |
| 06:17.48 | *** join/#debian n2deep (~n2deep@ns1.the808.com) |
| 06:18.21 | Bushmills | another alert i get is when cpu temperatures rises |
| 06:18.57 | jmarsden | chelz: If you want security related items, emails on reboot and emails on root login can also be good. |
| 06:19.37 | Bushmills | though consider the alternative to have servers send xmpp messages, instead of emails |
| 06:20.24 | chelz | all of that sounds pretty good |
| 06:21.00 | *** mode/#debian [+l 1031] by debhelper |
| 06:21.03 | chelz | yeah this is a single box so i'm wondering there's software that's pretty lightweight and ideally is designed for a single box, or at least doesn't assume i have a ton of machines |
| 06:22.24 | *** join/#debian ICEBreakPoint (~d3mux32@89.181.150.107) |
| 06:23.01 | Bushmills | those alerts are sent by munin, which isn't very heavy. it's essentially a graphing system monitor, and alerts are not munin's main function. it still sends them, though. |
| 06:23.44 | *** join/#debian Parsifal (~steven@CPE-121-217-146-59.lnse2.cht.bigpond.net.au) |
| 06:23.50 | chelz | Bushmills: why xmpp over emails? |
| 06:24.59 | Bushmills | chelz: i tend to have instant messenger running anyway. for example, for irc now. incoming xmpp don't need any mail biff, but show up in their own tab immediately |
| 06:25.22 | *** join/#debian flash_ (~ashley@115.6.233.220.static.exetel.com.au) |
| 06:25.25 | *** join/#debian thinksteve (~stephan@p579BD365.dip.t-dialin.net) |
| 06:25.31 | Bushmills | also, no need to delete messages, they just scroll off, eventually |
| 06:26.33 | Bushmills | and having multiple messages on one single page, instead of in multiple seperate emails. |
| 06:27.39 | ssfdre38 | where is the image of the KDE log-in background is stored at? |
| 06:28.09 | streuner | ssfdre38: dpkg -L kdm? |
| 06:28.36 | *** join/#debian MrOpposite (~mropposit@unaffiliated/mropposite) |
| 06:30.09 | *** join/#debian davidjm (david@hades.spexhost.com) |
| 06:30.29 | *** join/#debian derchris (~derchris@78-86-128-162.zone2.bethere.co.uk) |
| 06:30.30 | *** join/#debian foetus (~norbi@dslb-178-005-115-140.pools.arcor-ip.net) |
| 06:30.35 | *** join/#debian manio (~mariusz@87-206-100-87.dynamic.chello.pl) |
| 06:31.15 | *** join/#debian davidisko (~davidisko@nat-88-212-40-164.antik.sk) |
| 06:31.49 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 06:33.39 | *** join/#debian buhman (~zack@unaffiliated/zjblabs) |
| 06:33.48 | *** join/#debian creaux (~creaux@unaffiliated/creaux) |
| 06:34.28 | *** join/#debian ealdor (~ealdor@180.Red-79-156-131.staticIP.rima-tde.net) |
| 06:34.53 | *** join/#debian Morten_ (~morten@fw2.nbi.dk) |
| 06:38.36 | *** join/#debian CrashFr (~CrashFr@sto93-2-82-228-142-248.fbx.proxad.net) |
| 06:39.10 | *** join/#debian mastroDani (~Daniele@85-18-52-10.ip.fastwebnet.it) |
| 06:39.55 | *** join/#debian acx0 (~acx0@CPE0014bf4aede6-CM001a668303b2.cpe.net.cable.rogers.com) |
| 06:41.08 | *** join/#debian s0d0 (~sod@host81-141-52-233.wlms-broadband.com) |
| 06:42.26 | *** join/#debian return13 (~return13@ux-2800.inf.fh-bonn-rhein-sieg.de) |
| 06:46.53 | *** join/#debian tempeldirne (~L@gssn-5f7575c0.pool.mediaWays.net) |
| 06:46.53 | *** join/#debian onosendai (~onosendai@unaffiliated/onosendai) |
| 06:49.29 | *** join/#debian ali3n0 (~alieno@93-32-186-29.ip34.fastwebnet.it) |
| 06:52.17 | micols | ifup ppp1 (and iface eth1 inet manual in interfaces) , debian automagically ifups it as ppp0 , how do I fix this, I want to ifup it as 'vpn' name or similar |
| 06:53.11 | micols | if I have both ppp0 and ppp1 in interfaces file, it will named them ppp0 and ppp1 in ifconfig after which was upped last. |
| 06:53.27 | micols | kind of what I was hoping my udev rules would avoid |
| 06:53.43 | micols | I have /dev/bluetooth for my bluetooth dialup, /dev/sierra for my 3g card etc. |
| 06:53.50 | yagoo | udev doesnt take care of interfaces |
| 06:54.09 | yagoo | but u can use modules alias to force ppp0 if u want to |
| 06:54.20 | yagoo | i bet u can.. i know u can with eth0 |
| 06:54.39 | micols | only can find something named 'mapping' in the manpage |
| 06:54.44 | micols | modules , alias are not keywords in it |
| 06:54.51 | *** join/#debian isidore (~quassel@85.26.76.226) |
| 06:56.33 | *** join/#debian bleepbloop (~bleepbloo@ip68-107-135-187.tc.ph.cox.net) |
| 06:57.18 | *** part/#debian bleepbloop (~bleepbloo@ip68-107-135-187.tc.ph.cox.net) |
| 06:57.19 | catsup | udev does name interfaces although the ppp ones might be created by pppd. but, interfaces(5) doesn't name interfaces, it only configures them according to names |
| 06:57.25 | *** join/#debian dschoepe (~dschoepe@unaffiliated/dschoepe) |
| 06:58.23 | *** join/#debian desti (~desti@dslb-092-072-210-135.pools.arcor-ip.net) |
| 06:58.34 | chelz | Bushmills: ah, all good points |
| 06:59.01 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 06:59.09 | micols | yes I am using pppd |
| 06:59.09 | *** join/#debian jaytaph (~jaytaph@83.232.96.217) |
| 06:59.34 | micols | but I have no naming except iface ppp0 inet manual , and iface ppp1 inet manual, so as you say it must be naming them automagically, or the ifup scripts do |
| 06:59.56 | catsup | no |
| 07:00.22 | catsup | the file 'interfaces' is the configuration file for the package 'ifupdown' |
| 07:01.01 | catsup | that package, 'ifupdown', does not name interfaces at all. that has to be done by another part of the system. for hardware devices that is udev. for virtual devices, it is probably the software initializing the virtual device which names it. |
| 07:01.10 | micols | seems it (pppd) sets IFNAME , perhaps if I could overrride that |
| 07:01.15 | catsup | yes |
| 07:01.31 | catsup | yes |
| 07:01.39 | catsup | oops |
| 07:01.58 | *** join/#debian Sashi1 (~Sashi@S0106485b39e8054d.vc.shawcable.net) |
| 07:02.58 | *** join/#debian LaughingDuckk_ (~LaughingD@ADijon-552-1-21-252.w92-138.abo.wanadoo.fr) |
| 07:03.08 | *** join/#debian larsivi (~quassel@131-162-212.connect.netcom.no) |
| 07:04.05 | *** join/#debian cga (~gacallea@cemitftp.mondadori.it) |
| 07:04.51 | *** join/#debian flash_ (~ashley@115.6.233.220.static.exetel.com.au) |
| 07:05.06 | micols | udev does renaming of normal interfaces, it renames eth0 and wifi0 for me using my rules |
| 07:05.16 | micols | but since my ppp don't have macs apparently it will not rename them |
| 07:05.57 | *** join/#debian jujugre (~julienb@artis3.probesys.com) |
| 07:06.42 | *** join/#debian BWMerlin (~BW~Merlin@CPE-60-226-105-114.qld.bigpond.net.au) |
| 07:07.12 | *** join/#debian ycat (~Yann@chello080109049190.2.14.univie.teleweb.at) |
| 07:08.17 | *** join/#debian Cromulent (~Cromulent@cpc8-reig4-2-0-cust24.6-3.cable.virginmedia.com) |
| 07:08.29 | *** join/#debian Texou (~Texou@unaffiliated/texou) |
| 07:08.30 | micols | ahh nice |
| 07:08.39 | micols | 'unit x' option works |
| 07:08.46 | micols | where x is an integer, will rename to pppx |
| 07:09.20 | micols | wouldn't have guessed that was what I needed to search for |
| 07:09.32 | micols | also it was a pppd option |
| 07:10.10 | *** join/#debian lyte (~lyte@unaffiliated/neerolyte) |
| 07:11.00 | *** mode/#debian [+l 1046] by debhelper |
| 07:11.06 | catsup | unit? in what? |
| 07:11.52 | jmarsden | catsup: pppd.conf |
| 07:12.02 | catsup | oh |
| 07:12.04 | jmarsden | or whatever... man pppd there is a unit option. |
| 07:12.19 | *** join/#debian zerodeux (~zerodeux@bearstech/zerodeux) |
| 07:12.24 | *** join/#debian EBZ_ (~EBZ@port-83-236-201-59.static.qsc.de) |
| 07:12.46 | *** join/#debian Raptors23 (yuixcx@dsl-69-172-118-72.acanac.net) |
| 07:13.41 | shellox | [09:08] [] [1] |
| 07:13.41 | shellox | [(status)] |
| 07:13.49 | shellox | sorry |
| 07:14.15 | *** join/#debian zorg1 (~zorg1@artis3.probesys.com) |
| 07:14.45 | micols | catsup: i did it in my interfaces file, as option to pppd |
| 07:15.09 | micols | Connect: ppp1 <--> /dev/bluetooth , works fine :) |
| 07:15.50 | micols | so can use the panel buttons to toggle interfaces now, was hard before as 3g might be ppp0 or ppp1, and gprs might be ppp0 and ppp1 (have one pcmcia 3g card and bluetooth cellphone with gprs) |
| 07:16.25 | micols | it would be named after last up interface,that would be eth1 always |
| 07:16.34 | *** join/#debian snoozy (bc50c316@gateway/web/freenode/ip.188.80.195.22) |
| 07:16.57 | *** join/#debian xtr (~058452959@64-46-16-152.dyn.novuscom.net) |
| 07:17.49 | micols | now I just need a grep line for interfaces to grep for integer in ${IFACE} |
| 07:18.17 | micols | so I can use unit x , where x is the integer I set last in 'iface pppx inet manual' |
| 07:18.33 | micols | so I only have to change the top line |
| 07:19.09 | catsup | ha |
| 07:19.26 | *** join/#debian MikeH` (~mike@2001:470:1f09:14ed:3058:a330:1cac:4612) |
| 07:19.36 | catsup | you want to put a command in interfaces that, when called from interfaces, reads the interfaces file itself? |
| 07:19.41 | *** join/#debian MrGeneral (~MrGeneral@ipv6.miguelsp.net) |
| 07:19.47 | catsup | so that you don't have to change the constant in two places?? |
| 07:20.34 | micols | http://pastebin.com/UCw9nhAG |
| 07:21.09 | micols | I want to make that bashishm work in interfaces, so I can ifup the interface and it will replace that `bashcmd` with unitnum where unitnum is the integer in ppp<integer> |
| 07:22.21 | *** join/#debian pyro__ (~pyro___@unaffiliated/pyro-/x-1498221) |
| 07:22.32 | *** join/#debian cga (~cga@cemitftp.mondadori.it) |
| 07:22.52 | micols | for 'iface ppp1 inet manual' it should call pppd with 'unit 1', and ${IFACE} is set by ifup automagically |
| 07:23.05 | micols | IFACE == ppp1 , just need to extract the 1 :) |
| 07:23.40 | *** join/#debian muddo (debian-tor@gateway/tor-sasl/muddo) |
| 07:24.13 | *** join/#debian binbrain (~binbrain@ool-43565f5f.dyn.optonline.net) |
| 07:24.33 | *** join/#debian xingu (~xingu@cl-1387.ams-04.nl.sixxs.net) |
| 07:25.40 | Bushmills | micols: echo ${IFACE}|grep -o '.$'` -> echo ${IFACE##*.} |
| 07:26.06 | Bushmills | or echo ${IFACE#*.}, actually |
| 07:26.34 | *** join/#debian zenner (~zen@2001:470:8d23:fe:ed5:dc2:0:77) |
| 07:26.51 | *** join/#debian muh2000 (~muh2000@unaffiliated/muh2000) |
| 07:27.42 | Bushmills | <PROTECTED> |
| 07:28.22 | *** join/#debian MrGeneral (~MrGeneral@ipv6.miguelsp.net) |
| 07:28.42 | *** join/#debian sphenxes (~sphenxes@85-127-213-25.dynamic.xdsl-line.inode.at) |
| 07:30.01 | *** join/#debian B|ackbird (tanta@unaffiliated/backbird/x-3237639) |
| 07:30.06 | *** join/#debian Seraphin (~julien@gut75-2-82-225-241-177.fbx.proxad.net) |
| 07:30.19 | Bushmills | sry. ${IFACE: -1} ... misread . as matching dot instead of any char. last char you want, right? |
| 07:32.09 | *** join/#debian jelly-home (~jelly@homestuck.iskon.hr) |
| 07:32.30 | *** join/#debian Calyp (~Caly@unaffiliated/calyptratus-tzm) |
| 07:32.43 | *** join/#debian LaughingDuckk_ (~LaughingD@ADijon-552-1-21-252.w92-138.abo.wanadoo.fr) |
| 07:33.17 | yagoo | Bushmills, ${UFACE :-} .. sry |
| 07:33.31 | llutz | Bushmills: isn't it ${IFACE:1,-1} to get last char? |
| 07:33.38 | yagoo | :) |
| 07:34.01 | yagoo | pokes around with ${interfaces} |
| 07:34.07 | *** join/#debian bocaneri (~sauvin@about/linux/staff/sauvin) |
| 07:34.27 | Bushmills | llutz: alternatively |
| 07:34.28 | llutz | argh, missing space, sry : -1 |
| 07:35.20 | *** join/#debian Benkinooby (~Benkinoob@etx-public-dock-250-dhcp.ethz.ch) |
| 07:35.20 | *** join/#debian Benkinooby (~Benkinoob@unaffiliated/benkinooby) |
| 07:35.44 | *** join/#debian ICEBreakPoint (~d3mux32@89-181-150-107.net.novis.pt) |
| 07:36.00 | Bushmills | start index makes sense for taking a section from the middle of a string. for addressing from first or last char, it's not really needed |
| 07:36.10 | *** join/#debian LaughingDuckk_ (~LaughingD@ADijon-552-1-21-252.w92-138.abo.wanadoo.fr) |
| 07:36.11 | micols | Bushmills: yes last char |
| 07:36.22 | micols | so what you wrote is not what I want I think |
| 07:36.25 | llutz | Bushmills: i see |
| 07:36.42 | Bushmills | micols: what i wrote after that should be right then |
| 07:37.38 | *** join/#debian Tom01 (~tom@p5DDFF389.dip.t-dialin.net) |
| 07:38.33 | jmarsden | michols: Perhaps you want ${IFACE##ppp} # trims ppp off the front, in case you get up to ppp42 or something :) |
| 07:39.14 | Bushmills | non-greedy # should do there |
| 07:39.16 | *** join/#debian KBme (~KBme@2001:470:cabe:666:666:666:666:666) |
| 07:39.46 | *** join/#debian Python1320 (Python1320@2001:470:dd3b:1337:3153:64e7:3927:9c0a) |
| 07:39.46 | *** join/#debian Python1320 (Python1320@unaffiliated/python1320) |
| 07:40.01 | *** join/#debian starenka_ (~starenka@m229.dkm.cz) |
| 07:40.15 | jmarsden | Right, either way works because ppp is always exactly 3 chars long :) |
| 07:40.55 | *** join/#debian tvm (~tvm@85.93.121.30) |
| 07:41.18 | *** join/#debian Neo (~Neo@unaffiliated/alpsinc) |
| 07:41.50 | *** join/#debian shellox (~EBZ@port-83-236-201-59.static.qsc.de) |
| 07:42.15 | *** join/#debian asias (~asias@apicoo.com) |
| 07:43.43 | *** join/#debian gartt (~gart@ip68-0-206-237.ri.ri.cox.net) |
| 07:46.01 | *** join/#debian nicoulaj (~nicoulaj@129.184.84.41) |
| 07:46.37 | *** join/#debian Glebelg (~Glebelg@unaffiliated/glebelg) |
| 07:47.45 | *** join/#debian B3rz3rk3r (~B3rz3rk3r@ipv6-apollo.digitaluppercut.com) |
| 07:48.27 | *** join/#debian digdilem_ (~digdilem_@host86-134-81-101.range86-134.btcentralplus.com) |
| 07:49.10 | *** join/#debian jazz (~Adium@hyperion.ups-tlse.fr) |
| 07:49.11 | *** join/#debian Cueball_ (~lee@2001:8b0:ffb3::c0:ff:ee) |
| 07:50.00 | *** join/#debian robertdavid (~Robert@gate.chabry.cz) |
| 07:50.15 | *** join/#debian Ergo^ (~ergo@hyp-p-107.pabianice.msk.pl) |
| 07:50.43 | *** join/#debian xiaoy (~unknown@151.95.216.92) |
| 07:54.30 | *** join/#debian chipotle (~chipotle@209-6-67-222.c3-0.abr-ubr1.sbo-abr.ma.cable.rcn.com) |
| 07:54.46 | buhman | I've been having terrible trouble with empathy |
| 07:55.04 | *** join/#debian Azrael_- (~awef@p579991AD.dip.t-dialin.net) |
| 07:55.29 | *** part/#debian Boltsky (~bolt@2001:470:d:dd3:e2f8:47ff:fe20:3088) |
| 07:55.30 | buhman | it works when I first install squeeze, but later on it refuses to work responding with "Segmentation fault" every time I execute it |
| 07:56.39 | streuner | Is the RAM ok? |
| 07:56.53 | *** join/#debian morn__ (~morn@melian.0ptr.net) |
| 07:57.12 | *** join/#debian wissem (~wissem@unaffiliated/wissem) |
| 07:57.44 | Bushmills | buhman: ltrace and strace may - or may not - give you a hint of what the problem is |
| 07:57.47 | *** join/#debian osfd (~olivier@rke75-8-78-225-170-15.fbx.proxad.net) |
| 07:58.27 | *** join/#debian flokuehn (~flokuehn@213.252.4.21) |
| 07:58.58 | *** join/#debian LaughingDuckk_ (~LaughingD@195.88.84.151) |
| 07:59.50 | Bushmills | is that on debian stable? |
| 08:01.34 | *** join/#debian Benwa (~Schnitzel@unaffiliated/benwa) |
| 08:01.55 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 08:02.01 | Andorin | Well, that's not a good sign... I just installed squeeze on my laptop and I don't think apt got configured correctly. When I try to check for updates it says "could not download package information." |
| 08:02.11 | buhman | Bushmills: yes |
| 08:02.35 | buhman | Bushmills: just installed today on this machine |
| 08:02.56 | *** join/#debian catsup (d@ps38852.dreamhost.com) |
| 08:03.10 | *** join/#debian Sp4rKy (~Sp4rKy@freenode/sponsor/domogik.founder.sp4rky) |
| 08:03.13 | *** part/#debian Sp4rKy (~Sp4rKy@freenode/sponsor/domogik.founder.sp4rky) |
| 08:03.19 | *** join/#debian MUILTFN (~MLINTH@adsl-98-80-204-104.mcn.bellsouth.net) |
| 08:03.47 | *** join/#debian catsup (d@ps38852.dreamhost.com) |
| 08:03.48 | *** join/#debian jaytaph (~jaytaph@83.232.96.217) |
| 08:04.09 | *** join/#debian lewnidas_ (~lewnidas_@188.4.39.253) |
| 08:04.57 | *** join/#debian pierrep (~pierrep@bas2-montreal42-1096617044.dsl.bell.ca) |
| 08:05.50 | *** join/#debian Cyanure (~Cyanure@212-198-160-108.rev.numericable.fr) |
| 08:05.55 | *** join/#debian Jordan_U (~jordan@216.57.70.194) |
| 08:05.59 | micols | Bushmills: thanks it worked |
| 08:06.15 | micols | also I remember seeing this before now after you wrote it :) |
| 08:06.19 | *** join/#debian Benkinooby (~Benkinoob@unaffiliated/benkinooby) |
| 08:06.22 | buhman | in another machine I played with, I dist-upgraded to testing, same problem, upgraded to unstable: same problem. |
| 08:06.36 | Bushmills | micols: jmarsden's suggestion works too, and may be preferabl |
| 08:06.37 | *** join/#debian ICEBreakPoint (~d3mux32@89.181.150.107) |
| 08:06.38 | Bushmills | le |
| 08:06.59 | micols | Bushmills: yes I used the nongreedy # |
| 08:07.12 | webad_13 | how to check my color current color depth in console? |
| 08:07.49 | *** join/#debian alphamail (~alphamail@5403492D.catv.pool.telekom.hu) |
| 08:07.54 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 08:08.12 | Bushmills | micols: but whichever you pick, get rid of the `echo ...` |
| 08:08.39 | *** join/#debian Raphaelt (~Raphaelt@ret08-1-88-182-200-157.fbx.proxad.net) |
| 08:08.51 | webad_13 | how to check my current color depth in console?* |
| 08:09.16 | *** join/#debian bp0 (~bp@unaffiliated/bp0) |
| 08:09.24 | alphamail | still trying to find out how to intalld debian, day 3 |
| 08:10.08 | Bushmills | alphamail: have you renewed your subscription to debian install images? |
| 08:10.17 | alphamail | ? |
| 08:10.50 | jmarsden | webad_13: xwininfo -root | grep Depth: |
| 08:10.51 | *** join/#debian NurIch_ (~NurIch_@137.226.154.136) |
| 08:10.59 | Bushmills | not that they bar you access because of your expired subscription |
| 08:11.00 | *** mode/#debian [+l 1053] by debhelper |
| 08:11.17 | alphamail | i dont know what debian install images is |
| 08:11.52 | Bushmills | ah. an installation image is a valuable instrument for installing debian |
| 08:12.02 | alphamail | i have three isos |
| 08:12.14 | alphamail | net, squeeze and live |
| 08:12.47 | Bushmills | well, you can't eat your cake, and have it, they say |
| 08:12.51 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 08:12.54 | alphamail | lol |
| 08:13.06 | alphamail | i dont care which one i use, i just want to install something |
| 08:14.21 | *** join/#debian arif-ali (~arif-ali@ip-81-23-53-226.ask4internet.com) |
| 08:14.21 | micols | Bushmills: yes, I just added the parameter expansion lookalike you gave me, it looks a bit cleaner :) |
| 08:14.33 | micols | or that jmarsden wrote |
| 08:14.48 | Bushmills | later this day i'll push one install cd into the hands of a person who is barey able to launch a web browser on windows. then i'll watch how installation goes :) |
| 08:15.18 | webad_13 | jmarsden, forgot to mention - no x server... is there a similar option with framebuffer |
| 08:15.37 | alphamail | i have no cd drive |
| 08:15.39 | Bushmills | i may have to interfere at the point he's about to wipe his windows installation on the first hard disk |
| 08:15.47 | alphamail | and im running wine windows from puppy |
| 08:15.55 | *** join/#debian harobed (~harobed@pda57-1-82-231-115-1.fbx.proxad.net) |
| 08:15.55 | alphamail | if i was on windows machine it would be easy |
| 08:16.04 | Bushmills | alphamail: live image should be usb bootable |
| 08:16.19 | *** join/#debian MikeH` (~mike@2001:470:1f09:14ed:3058:a330:1cac:4612) |
| 08:16.22 | Bushmills | flash stick, that is |
| 08:16.29 | alphamail | my usb drive is already bootable and dont want to overwrite it |
| 08:16.39 | jmarsden | webad_13: I don't know... machines with no X are, for me, machines I don't need graphics on the console of :) I'll take a quick look... |
| 08:16.51 | Bushmills | you could contemplate using a different one? |
| 08:16.54 | *** join/#debian gartt (~gart@ip68-0-206-237.ri.ri.cox.net) |
| 08:17.02 | alphamail | i dont have one |
| 08:17.07 | jmarsden | alphamail: usb drives are pretty inexpensive these days :) |
| 08:17.13 | alphamail | i could buy a new one but it should be possible to install without buying a new one? |
| 08:17.15 | *** join/#debian Dunedan (~dunedan@phoenitydawn.de) |
| 08:17.18 | alphamail | yea true that |
| 08:17.23 | alphamail | it's just a principle now |
| 08:17.47 | Bushmills | well, backup your existing drive, than write live image to it. after installation, restore from backup |
| 08:17.57 | Bushmills | then ... |
| 08:18.02 | alphamail | good idea |
| 08:18.17 | *** join/#debian [bean] (~anarchy@184.18.7.165) |
| 08:18.21 | *** join/#debian Evg33 (~Evg33@irc.ipv6.evg33.ru) |
| 08:18.43 | alphamail | do you know where to find syslinux.cfg fro debian |
| 08:19.14 | alphamail | there is a multi iso boot template for puppy i just need the right grub commands for install |
| 08:19.40 | jmarsden | webad_13: fbset |
| 08:19.43 | *** join/#debian verwilst (~verwilst@router.begen1.office.netnoc.eu) |
| 08:20.12 | Bushmills | alphamail: to avoid purchasing another flash stick, you could borrow one from your neighbours? |
| 08:20.20 | alphamail | lol |
| 08:20.27 | alphamail | my gf has one that is 100 mb |
| 08:20.37 | *** join/#debian larsivi (~quassel@131-162-212.connect.netcom.no) |
| 08:20.40 | Bushmills | a bit small. you want 1 GiB or 2 |
| 08:20.44 | alphamail | i know |
| 08:20.51 | Bushmills | for the full live images, that is |
| 08:21.03 | alphamail | can i use a spare usb hard drive? |
| 08:21.17 | *** join/#debian pbn (pbn@wopr.geekshells.org) |
| 08:21.40 | *** part/#debian Lobs (~lobo@125-237-186-254.jetstream.xtra.co.nz) |
| 08:21.58 | buhman | Bushmills: http://paste.pocoo.org/show/385695/ |
| 08:22.01 | Bushmills | what's the operating system you're running from your hard drive? |
| 08:22.11 | alphamail | my internal hard drive is puppy |
| 08:22.11 | buhman | Bushmills: I think I nailed down all of the debugging symbols... |
| 08:22.16 | *** join/#debian sandwitch (~sandwitch@247-50-223.ftth.xms.internl.net) |
| 08:22.29 | alphamail | i have a spare external i could format to whatever i want |
| 08:22.32 | alphamail | 150gb |
| 08:22.54 | Bushmills | alphamail: check whether there's dbootstrap available or obtainable |
| 08:23.00 | Bushmills | debootstrap |
| 08:23.04 | alphamail | i was trying to understand that yesterday |
| 08:23.23 | alphamail | it's still command line yes? |
| 08:23.29 | alphamail | you need wget and ar |
| 08:23.35 | alphamail | i have wget but didnt download ar |
| 08:24.12 | *** join/#debian c0nfl|ct (~tiagrei@83.240.134.68) |
| 08:24.34 | Bushmills | ar comes with binutils |
| 08:24.39 | *** join/#debian alcohol (~rob@unaffiliated/alcohol) |
| 08:24.41 | *** join/#debian alfadir (~alfadir@129.69.93.132) |
| 08:24.44 | alphamail | i have debootstrap installed |
| 08:24.55 | webad_13 | jmarsden this is what I get, how to interpret the color depth from it? http://pastebin.com/SyWMPAn0 |
| 08:25.17 | *** join/#debian mischief (~mischief@unaffiliated/mischief) |
| 08:26.08 | *** join/#debian mischief (~mischief@unaffiliated/mischief) |
| 08:26.19 | *** join/#debian digitalmortician (~digitalmo@3-254.197-178.cust.bluewin.ch) |
| 08:26.37 | jmarsden | webad_13: 32bit, I think, 5th number on the geometry line. |
| 08:26.52 | *** join/#debian smica (~smica@91.213.150.50) |
| 08:27.03 | *** join/#debian mischief (~mischief@adsl-76-246-63-67.dsl.scrm01.sbcglobal.net) |
| 08:27.03 | *** join/#debian mischief (~mischief@unaffiliated/mischief) |
| 08:27.31 | jmarsden | man fbset says that geometry is set as xres yres vxres vyres depth |
| 08:27.44 | *** join/#debian omeddragon (~omeddrago@pool-71-178-234-18.washdc.fios.verizon.net) |
| 08:27.52 | Bushmills | alphamail: debootstrap a squeeze installation to your usb drive, chroot to it with bind mounts of /proc, /dev and possibly /sys, then install kernel image, possibly also grub |
| 08:28.04 | alphamail | i need to get binutils first |
| 08:28.08 | alphamail | puppy is a real pain with some things |
| 08:28.31 | webad_13 | jmarsden, ok thank you - this is some high depth console :) |
| 08:28.33 | Bushmills | smaller is not always easier |
| 08:28.56 | alphamail | in the puppy world it is great, but when you try to go outside the little puppy world it gets complicated fast |
| 08:29.09 | alphamail | hence i'm here looking at ebian |
| 08:29.13 | *** part/#debian Grega (~grega@jimmy.webapps.si) |
| 08:29.38 | *** join/#debian arif-ali (~arif-ali@ip-81-23-53-226.ask4internet.com) |
| 08:29.40 | jmarsden | webad_13: You're welcome. |
| 08:29.53 | *** join/#debian e-anima (~eanima@p5DF5B3FC.dip.t-dialin.net) |
| 08:30.04 | Bushmills | alphamail: an alternative for future similar situations could be to set up a netboot server, for example your internet router, and net boot a net install from there |
| 08:30.54 | *** join/#debian larsivi (~quassel@131-162-212.connect.netcom.no) |
| 08:30.59 | shellox | will debian testing get rolling releases? |
| 08:31.10 | buhman | Bushmills: http://paste.pocoo.org/show/385698/ |
| 08:31.18 | alphamail | i would love to know how to do that |
| 08:31.18 | Bushmills | not "releases" but package updates |
| 08:31.37 | Bushmills | alphamail: having dnsmaq on router is half the rent |
| 08:31.42 | Bushmills | dnsmasq |
| 08:31.50 | buhman | not sure how to grab those libgl symbols |
| 08:31.54 | alphamail | you can upload that to a router? |
| 08:31.54 | *** join/#debian flash_ (~ashley@115.6.233.220.static.exetel.com.au) |
| 08:32.01 | Bushmills | openwrt provides it, for example |
| 08:32.33 | *** join/#debian flash_ (~ashley@115.6.233.220.static.exetel.com.au) |
| 08:32.47 | *** join/#debian Skaperen (~phil@c-76-125-202-149.hsd1.wv.comcast.net) |
| 08:34.23 | *** join/#debian manio (~mariusz@87-206-100-87.dynamic.chello.pl) |
| 08:34.40 | buhman | Bushmills: it actually looks like that' |
| 08:34.44 | buhman | that's related to fglrx |
| 08:34.58 | buhman | Bushmills: that makes sense: it worked before I installed fglrx |
| 08:35.11 | buhman | Bushmills: how might I get fglrx debugging symbols? |
| 08:35.17 | Bushmills | just by the sounds of it, i'd say it could well be |
| 08:36.16 | buhman | Bushmills: whenever I install the nonfree firmware for radeon, however, gnome crashes just as it starts logging in |
| 08:36.40 | buhman | Bushmills: I'd be willing to bet if I uninstalled that and fglrx, that empathy would suddenly start working |
| 08:37.10 | *** join/#debian achadwick (~achadwick@nat-alpha.ceu.ox.ac.uk) |
| 08:37.18 | Bushmills | buhman: i heard several people complaining about non-free fglrx. you'd not be the first one. |
| 08:37.23 | *** join/#debian NoobCoder (~unknowni@x1-6-e0-91-f5-90-af-9e.k62.webspeed.dk) |
| 08:37.27 | *** join/#debian kaiyin (~kaiyin@2001:250:208:2022:224:81ff:fe53:95db) |
| 08:38.12 | *** join/#debian eSa| (~esa@host121-234-dynamic.245-95-r.retail.telecomitalia.it) |
| 08:38.14 | buhman | Bushmills: I've generally been very succesful with it, actually |
| 08:38.19 | *** join/#debian cheasee (~vchrizz@78.142.179.175) |
| 08:38.22 | c0nfl|ct | <PROTECTED> |
| 08:39.20 | buhman | Bushmills: fglrxinfo segfaults too... |
| 08:39.50 | *** join/#debian sphenxes01 (~sphenxes0@85-127-213-25.dynamic.xdsl-line.inode.at) |
| 08:40.40 | *** join/#debian dgm_077 (~dgm_077@port-92-206-62-31.dynamic.qsc.de) |
| 08:41.00 | *** mode/#debian [+l 1061] by debhelper |
| 08:41.18 | *** part/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 08:41.29 | *** join/#debian buhman (~zack@unaffiliated/zjblabs) |
| 08:41.50 | buhman | solved it: ran aticonfig --initial and restarted X; solved everything |
| 08:42.27 | *** join/#debian on1ald (~ben@178-118-136-88.access.telenet.be) |
| 08:42.53 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 08:44.18 | *** join/#debian cosmodad (~treimann@unaffiliated/cosmodad) |
| 08:44.41 | *** join/#debian cheater_ (~cheater@p5099e3f2.dip0.t-ipconnect.de) |
| 08:45.48 | *** join/#debian pif (~ldm@zenon.apartia.fr) |
| 08:47.33 | alphamail | where does dnsmasq reside |
| 08:47.37 | alphamail | you said having it on the router |
| 08:49.27 | *** join/#debian lyte (~lyte@220-253-33-245.VIC.netspace.net.au) |
| 08:49.30 | *** join/#debian lyte (~lyte@unaffiliated/neerolyte) |
| 08:50.25 | alphamail | ok i finally got ar |
| 08:50.34 | *** join/#debian on1ald (~ben@178-118-136-88.access.telenet.be) |
| 08:50.45 | buhman | what's the difference between stable-updates and stable-proposed-updates? |
| 08:50.57 | buhman | would stable-propsed-updates include everything in stable-updates? |
| 08:51.07 | *** join/#debian Elirips (~eli@2001:620:400:64:2e0:81ff:fe5d:b254) |
| 08:51.22 | *** join/#debian themill (~stuart@unaffiliated/themill) |
| 08:52.14 | *** join/#debian muh2000 (~muh2000@unaffiliated/muh2000) |
| 08:52.19 | Elirips | Hello all. How can I rename files in a directory from 'foobar-001.ppm', 'foobar-002.ppm, 'foobar-003.ppm', etc. to '001.ppm', '002.ppm', '003.ppm', etc.? |
| 08:52.52 | Elirips | or: Does mv accept regular expressions? |
| 08:52.59 | ansgar | Elirips: rename does. |
| 08:53.12 | *** join/#debian atypic (atypic@anipsyche.net) |
| 08:53.29 | *** join/#debian cornair (~cornair@pd95c90a6.dip0.t-ipconnect.de) |
| 08:53.31 | *** join/#debian romel (~romel@unaffiliated/romel) |
| 08:53.45 | *** join/#debian Agiofws (~Agiofws@athedsl-429589.home.otenet.gr) |
| 08:54.01 | Elirips | ansgar, rename (?) indeed, that exists, never seen before. Thanks |
| 08:54.13 | *** join/#debian hiroyuki_y (~yamanaka_@mfac.st.wakwak.ne.jp) |
| 08:54.48 | jmarsden | Elirips: for i in foobar-* ; do mv $i `echo ${i#foobar-}` ; done # should work |
| 08:55.57 | *** join/#debian ignotusp (~ignotus@fleshless-dash.volia.net) |
| 08:56.28 | Elirips | jmarsden, what is the {i#foobar-} doing? Is this a short-version of 'echo $i | sed -i 's#foobar-##'? |
| 08:56.59 | jmarsden | Elirips: Sort of, it is a bashism.. man bash for more info |
| 08:57.05 | Elirips | jmarsden, thx |
| 08:57.16 | jmarsden | Elirips: You're welcome. |
| 08:58.12 | *** join/#debian MadameZou (~zoo@net-93-71-232-150.cust.dsl.vodafone.it) |
| 08:58.31 | *** join/#debian zz_Cogito (~Cogito@2001:4ba0:fff1:c2::2) |
| 08:58.51 | *** join/#debian krushik (~mayday@84.17.25.149) |
| 08:59.35 | *** join/#debian rigved (~rigved@116.72.171.56) |
| 09:01.36 | *** join/#debian rigved (~rigved@116.72.171.56) |
| 09:01.41 | *** join/#debian Floops (~baihu@2001:470:a073:0:a00:27ff:fea2:c438) |
| 09:02.16 | *** join/#debian somnus (~somnus@srbk-4d0b918f.pool.mediaWays.net) |
| 09:04.17 | cosmodad | can anyone tell me why trying to create a pbuilder tgz fails with this: |
| 09:04.17 | cosmodad | W: Failure trying to run: chroot /var/cache/pbuilder/build/14313/. mount -t proc proc /proc |
| 09:04.25 | *** join/#debian allan8904 (~allan@unaffiliated/allan8904) |
| 09:04.25 | cosmodad | E: debootstrap failed |
| 09:04.33 | *** join/#debian shingouz (shingouz@85-156-82-142.elisa-mobile.fi) |
| 09:04.53 | moty66 | is it possible to mount an AFP network drive shared by a mac machine ? |
| 09:05.51 | *** join/#debian mezod (nnscript@unaffiliated/mezod) |
| 09:06.03 | *** part/#debian MadameZou (~zoo@net-93-71-232-150.cust.dsl.vodafone.it) |
| 09:06.16 | *** join/#debian daemonkeeper (~Arno@unaffiliated/metalfoo) |
| 09:06.49 | alphamail | does debootstrap have to be on the partition you will be downloading to |
| 09:07.27 | *** join/#debian Cisien_ (~chris@2001:470:e883::100) |
| 09:08.40 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 09:12.22 | *** join/#debian nviror (~navi@122.162.73.48) |
| 09:12.40 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 09:14.12 | *** join/#debian sphenxes01 (~sphenxes0@85-127-213-25.dynamic.xdsl-line.inode.at) |
| 09:14.15 | *** join/#debian Nebukadneza (~Nebukadne@h1749472.stratoserver.net) |
| 09:14.16 | Nebukadneza | heho |
| 09:15.00 | *** join/#debian musolinoa (~alex@CPE-124-178-192-222.lns3.way.bigpond.net.au) |
| 09:15.00 | *** join/#debian musolinoa (~alex@fedora/musolinoa) |
| 09:15.12 | Nebukadneza | i've just tried updating to 2.6.38-2 on my home-server-router-thingy which has a foredeth ethernet adaptor identified as "00:0a.0 Ethernet controller: nVidia Corporation Unknown device 054c (rev a2)" in lspci |
| 09:15.45 | *** join/#debian pistolpete (~pistolpet@p57ACF1E3.dip.t-dialin.net) |
| 09:15.48 | Nebukadneza | i've somehow run into a regression from 2.6.35 - the forcedeth network driver has packet loss of > 50% on 2.6.38 - regardless of the speed and/or duplex setting |
| 09:16.14 | *** join/#debian dawud (~dawud@229.144.217.87.dynamic.jazztel.es) |
| 09:16.24 | Nebukadneza | does anybody know anything about that? :/ |
| 09:16.54 | *** join/#debian NoobCoder (unknowni@x1-6-e0-91-f5-90-af-9e.k62.webspeed.dk) |
| 09:17.10 | *** join/#debian sjoerd (~sjoerd@tunnel3460.ipv6.xs4all.nl) |
| 09:17.27 | *** join/#debian abcd82 (~abcd@109.110.18.181) |
| 09:18.52 | *** part/#debian rigved (~rigved@116.72.171.56) |
| 09:19.49 | *** join/#debian pistolpete (~pistolpet@p57ACF1E3.dip.t-dialin.net) |
| 09:19.58 | *** join/#debian eshat (~eshat@2001:638:504:c018:226:2dff:fef6:1d80) |
| 09:21.00 | *** mode/#debian [+l 1067] by debhelper |
| 09:21.45 | *** join/#debian sekt0r (~sekt0r@80.250.174.45) |
| 09:21.53 | *** join/#debian n2deep (~n2deep@ns2.the808.com) |
| 09:23.18 | *** join/#debian bzed (~bzed@devel.recluse.de) |
| 09:26.59 | *** join/#debian aspect (~aspect@abstracted-spleen.org) |
| 09:27.08 | *** join/#debian alfadir (~alfadir@129.69.93.132) |
| 09:27.31 | *** join/#debian freeloader (~freeloade@194.126.28.237) |
| 09:28.09 | alfadir | hi, with apache2, compressing html pages, serves files as download. expected that it "should just work". what do i have to adapt for debian ? http://httpd.apache.org/docs/current/content-negotiation.html#naming |
| 09:28.14 | *** join/#debian babilen (~babilen@unaffiliated/babilen) |
| 09:28.30 | alfadir | Filename foo.en.html.gz |
| 09:29.16 | *** join/#debian grandie (~thomas@p57ACF1E3.dip.t-dialin.net) |
| 09:29.40 | *** join/#debian g0bl1n (~g0bl1n@unaffiliated/g0bl1n) |
| 09:31.07 | *** join/#debian ICEBreakPoint (~d3mux32@89.181.150.107) |
| 09:31.29 | *** join/#debian webad_13 (~milos@193.205.17.135) |
| 09:31.38 | *** join/#debian madi (~madi@193.204.22.100) |
| 09:31.38 | *** join/#debian madi (~madi@unaffiliated/madi) |
| 09:32.29 | *** join/#debian gosi (~gosi@fw.office-fra1.proio.com) |
| 09:32.33 | *** join/#debian MartyD (~martyd@unaffiliated/martyd) |
| 09:34.50 | *** join/#debian MUILTFN (~MLINTH@adsl-98-80-203-191.mcn.bellsouth.net) |
| 09:34.58 | *** join/#debian webad_13 (~milos@193.205.17.135) |
| 09:36.01 | *** join/#debian Nu^253r (~LessIsMor@2.176.247.204) |
| 09:36.34 | *** join/#debian DimmuR (~DimmuR@unaffiliated/dimmur) |
| 09:36.55 | *** join/#debian mshindo (~mshindo@203-114-166-191.dsl.sta.inspire.net.nz) |
| 09:37.06 | *** join/#debian Innocentus (~Innocentu@p57A23086.dip.t-dialin.net) |
| 09:37.09 | *** join/#debian LeoW- (~leow@2001:41d0:1:e771::1) |
| 09:38.08 | *** join/#debian AbsintheSyringe (~havoc@conference/ubuntudevelopersummit/x-ohlfxujewfmajttw) |
| 09:38.10 | *** join/#debian Jippi (~jippignu@109.202.139.50) |
| 09:39.27 | *** join/#debian m4v (~znc@unaffiliated/m4v) |
| 09:39.43 | *** join/#debian mi (~mi@unaffiliated/mi) |
| 09:41.00 | *** mode/#debian [+l 1079] by debhelper |
| 09:42.47 | *** join/#debian ozzloy (~ozzloy@ozzloy.lifeafterking.org) |
| 09:42.47 | *** join/#debian ozzloy (~ozzloy@unaffiliated/ozzloy) |
| 09:43.10 | *** join/#debian Kobaz (~kobaz@its.kobaz.net) |
| 09:43.16 | *** join/#debian ApEtc (~apetc@trevie-1-pt.tunnel.tserv15.lax1.ipv6.he.net) |
| 09:43.30 | *** join/#debian Yancho (~Matt@unaffiliated/yancho) |
| 09:43.40 | Elirips | Some little bit more complex renaming: How to rename from 'bin_foobar-001.png' to '001.bin.png' with a regexp, the number in the filenames change |
| 09:46.22 | babilen | Elirips: "man rename" + "man perlre" |
| 09:47.40 | *** join/#debian migbuntu64 (~migbuntu6@ppp-140-26.28-151.libero.it) |
| 09:47.57 | *** join/#debian Syman (b2653f2c@gateway/web/freenode/ip.178.101.63.44) |
| 09:48.04 | Elirips | babilen, fighting with that damn regexp :Pü |
| 09:48.06 | *** part/#debian Syman (b2653f2c@gateway/web/freenode/ip.178.101.63.44) |
| 09:48.32 | migbuntu64 | hello, it's any body on? |
| 09:48.34 | *** join/#debian Jippi (~jippignu@109.202.139.50) |
| 09:48.56 | migbuntu64 | qualcuno parla italiano? |
| 09:49.19 | ectospasm | I can't pair my bluetooth mouse. Neither bluetooth-applet, bluetooth-agent, or hidd can connect. All of these seem to detect the mouse OK, but the actual pairing fails. |
| 09:49.30 | babilen | migbuntu64: Do you use Ubuntu? |
| 09:49.49 | migbuntu64 | yes |
| 09:50.03 | ectospasm | migbuntu64: #ubuntu-it |
| 09:50.03 | Aim_Here | Elirips, for perl-compatible regexps, something like 's/(.+)_.+-(\d\d\d).png/\2.\1.png/' might work |
| 09:50.05 | *** join/#debian divergenta (~divergent@nl119-179-14.student.uu.se) |
| 09:50.06 | migbuntu64 | and debian in another partition |
| 09:50.17 | babilen | migbuntu64: Try #ubuntu-it in that case. (This is #debian and ubuntu is off-topic in here) ... Ciao! |
| 09:50.39 | Elirips | Aim_Here, thank you, I have now something really ugly like rename -v -n 's/bin_JJG_[0-9][0-9]\.[0-9][0-9]\.[0-9][0-9][0-9][0-9]-[0-9][0-9]\.[0-9][0-9]\.[0-9][0-9][0-9][0-9]-sauvola//' *.png but it seems to work |
| 09:51.07 | Elirips | (I'm sure someone with more knowledge about regexp could shorten that by 90% :P ) |
| 09:52.00 | migbuntu64 | oops!!!, but i've a problem on my debian partition, you now?, i've a multi-boot :D :D |
| 09:52.37 | *** join/#debian heroxbd (~user@2001:da8:200:102:222:19ff:fecd:5a91) |
| 09:52.38 | *** join/#debian Cyanure (~Cyanure@dhcp204-126.enst.fr) |
| 09:53.02 | *** join/#debian jargon- (~dayo@unaffiliated/jargon-) |
| 09:53.36 | *** join/#debian made_of_storm (~dudu@relay-co.nfsi.pt) |
| 09:53.43 | migbuntu64 | i'm chat on my ubuntu partition now :D , also, sorry about my english too :( |
| 09:53.58 | babilen | migbuntu64: No problem, what is your problem? |
| 09:54.04 | Bushmills | if there's a problem, you'll have to fix it |
| 09:54.31 | *** join/#debian ignotusp (~ignotus@fleshless-dash.volia.net) |
| 09:54.51 | Bushmills | generally speaking :) |
| 09:56.33 | *** join/#debian Tiffon (~name@79.109.206.90.dyn.user.ono.com) |
| 09:56.34 | *** join/#debian Tiffon (~name@unaffiliated/tiff0n) |
| 09:56.52 | *** join/#debian cdahmede- (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 09:57.02 | *** join/#debian Protux (~protux@ks303860.kimsufi.com) |
| 09:57.53 | *** join/#debian Holborn (~holborn@unaffiliated/holborn) |
| 09:58.30 | *** join/#debian aguitel_ (~aguitel@190.244.146.95) |
| 09:58.43 | migbuntu64 | ok, when i'm trying to use de rigth click on a file and try to open with: "open with another app..." , debian doesn't work anymore |
| 09:58.50 | *** join/#debian shingouz (shingouz@80-186-41-197.elisa-mobile.fi) |
| 09:58.59 | migbuntu64 | i'm slow by my english :( |
| 09:59.07 | yagoo | migbuntu64, bs |
| 09:59.16 | yagoo | migbuntu64, obviously |
| 09:59.23 | yagoo | migbuntu64, espagnol? |
| 09:59.27 | migbuntu64 | si |
| 09:59.28 | yagoo | !eas |
| 09:59.30 | yagoo | !es |
| 09:59.33 | migbuntu64 | nacì en Caracas |
| 09:59.43 | yagoo | i dont speak spanish really.. but there's channels |
| 09:59.46 | yagoo | sorry mate |
| 10:00.18 | yagoo | !es <<<<<<< fu dpkg!! |
| 10:00.18 | dpkg | <<<<<<< fu dpkg!!: Este canal es de soporte tecnico en Ingles para Debian. Si prefiere que el soporte sea en espanol, por favor ingrese a #debian-es con /join #debian-es tecleado en la linea de chat |
| 10:01.19 | *** join/#debian larsivi (~quassel@131-162-212.connect.netcom.no) |
| 10:01.33 | *** join/#debian Bop (~Vrooomm@84.23.217.110) |
| 10:02.44 | gnugr | is away: Îίμαι αÏαÏÏολημÎνοÏ/η |
| 10:03.11 | migbuntu64 | cuando trato de abrir una aplicacion en nautilus con click derecho el computador se me "cuelga", queda encantado, el servidor X no funciona mas :-P |
| 10:03.14 | gnugr | is back (gone 00:00:30) |
| 10:03.20 | cesurasean | hey guys, if I have a regular 10/100 router, and I setup a debian server with 2 or more NICs "bonded" together, will i be able to get any use out of the speed? or will it still be limited to 1 card worth of speed? will adding a 2nd card increase file transfer speed at all? am i wasting my time? |
| 10:05.04 | *** join/#debian ycat (~Yann@chello080109049190.2.14.univie.teleweb.at) |
| 10:05.47 | *** join/#debian thiagoss (~thiagoss@189.81.45.107) |
| 10:06.35 | *** join/#debian howareyou (~atari@lan46-730.kateka.lt) |
| 10:07.45 | *** join/#debian fender0107401 (~fender010@219.243.32.29) |
| 10:08.11 | rypervenche | I'm not sure if this question belongs here or not, so forgive me beforehand if it doesn't. I would like to record a screencast on Debian. I will be encoding it in theora/vorbis, but for the raw video I don't know what to use. All of the guides I see tell me to use H264, but I would like to follow the FOSS ideology. Any ideas? |
| 10:08.32 | migbuntu64 | i've a problem with nautilus on debian |
| 10:08.47 | migbuntu64 | tengo un probelma con nautilus en debian |
| 10:09.02 | migbuntu64 | ho un problema con nautilus in debian |
| 10:09.21 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-blsljymzgbsyzjjn) |
| 10:09.22 | migbuntu64 | :D |
| 10:10.31 | cesurasean | hey guys, if I have a regular 10/100 router, and I setup a debian server with 2 or more NICs "bonded" together, will i be able to get any use out of the speed? or will it still be limited to 1 card worth of speed? will adding a 2nd card increase file transfer speed at all? am i wasting my time? |
| 10:10.36 | cesurasean | can someone advise me? |
| 10:10.54 | *** part/#debian howareyou (~atari@lan46-730.kateka.lt) |
| 10:11.01 | dawud | migbuntu64: yo hablo español y puedo entender lo que escribes, pero los demás no. Si tienes problemas escribiendo en inglés, es mejor que preguntes en debian-es |
| 10:11.02 | *** join/#debian Protux (~protux@ks303860.kimsufi.com) |
| 10:11.27 | *** join/#debian mariusv (~marius@fsf/member/mariusv) |
| 10:12.16 | migbuntu64 | when i'm tryin to open a file, dx --> open with another app... , the system stops the X server and obviously, the desktop enviroment doesn't work |
| 10:12.46 | *** join/#debian mentor (~mentor@87.254.87.82) |
| 10:13.27 | dawud | migbuntu64: is there something useful in /var/log/messages or /var/log/X.0.log? |
| 10:13.41 | *** join/#debian happyhessian (~quassel@82.166.65.17) |
| 10:14.08 | migbuntu64 | hummm..., let me see.... |
| 10:14.37 | dawud | cesurasean: your router is connected to ADSL served by some ISP, isn't it? |
| 10:14.44 | cesurasean | cable |
| 10:14.50 | cesurasean | why does that matter? |
| 10:14.52 | dawud | what speed? |
| 10:14.58 | cesurasean | not sure |
| 10:15.01 | cesurasean | broadband |
| 10:15.11 | migbuntu64 | mountin the partition with debian..., wait please... |
| 10:15.12 | cesurasean | im transferring files within my lan though |
| 10:15.37 | dawud | you can have more speed than the speed served to you by your ISP, no matter how many NICs you bond |
| 10:15.39 | cesurasean | what is a good network monitoring tool for debian that's in a base install? |
| 10:15.49 | dawud | s/can/can't |
| 10:15.59 | cesurasean | dawud, if i bond 2 nics, can i see speed increase from a regular 10/100 router? |
| 10:16.07 | yagoo | dawud, he said within his lan |
| 10:16.11 | cesurasean | over wifi? |
| 10:16.14 | yagoo | cesurasean, ? |
| 10:16.16 | cesurasean | 802.11g |
| 10:16.27 | cesurasean | will adding another nic speed things up? |
| 10:16.44 | yagoo | cesurasean, no |
| 10:17.04 | dawud | yagoo: ok |
| 10:17.04 | *** join/#debian satish_ (daf82315@gateway/web/freenode/ip.218.248.35.21) |
| 10:17.07 | *** join/#debian binbrain (~binbrain@ool-43565f5f.dyn.optonline.net) |
| 10:17.21 | cesurasean | yagoo, what is a good network monitoring tool for debian that's in a base install? |
| 10:17.26 | yagoo | cesurasean, if u want good speed.. make sure u use cat6 cables.. |
| 10:17.37 | dawud | cesurasean: what you want to monitor? bandwidth? bmon is good enough |
| 10:17.42 | *** join/#debian kurkale6ka (~chatzilla@gatek.thls.bbc.co.uk) |
| 10:18.06 | migbuntu64 | wait please |
| 10:18.17 | petemc | cat6 cables for a 10/100 router? whats the point of that? |
| 10:18.25 | yagoo | cesurasean, u using sftp or ftp |
| 10:18.25 | yagoo | ? |
| 10:18.40 | yagoo | cesurasean, if its just on ur lan for file transferring.. its fine to use ftp.. |
| 10:18.52 | cesurasean | im using samba |
| 10:19.00 | cesurasean | so neither ftp or sftp. :D |
| 10:19.22 | *** join/#debian Auron (~auron@61.152.132.103) |
| 10:19.28 | petemc | cesurasean: for what its worth, a gigabit switch should cost about the same as 6 beers |
| 10:19.29 | yagoo | well if u want fastest speed dont use any encryption.. |
| 10:20.41 | *** join/#debian happyhessian (~quassel@82.166.65.17) |
| 10:21.17 | cesurasean | what do you mean by any encryption? for the password? |
| 10:21.26 | migbuntu64 | i don't find anything about the error of nautilus ??? |
| 10:21.55 | cesurasean | thanks guys |
| 10:22.16 | *** join/#debian movl (~movl@89.47.83.116) |
| 10:23.10 | migbuntu64 | it's like a bug..., you now?, all works fine, compiz an desktop enviroment, all, but when i'm stops on a "open with another app.." with nautilus, the server X broke and freez... |
| 10:23.58 | dawud | migbuntu64: launch nautilus from commandline without backgrounding it, see if you can repro the error, e if ogs sth useful |
| 10:24.08 | dawud | migbuntu64: launch nautilus from commandline without backgrounding it, see if you can repro the error, see if it logs sth useful |
| 10:25.04 | dawud | migbuntu64: I don't use nautilus, but maybe it can be launched with extra verbosity or debug options |
| 10:25.25 | migbuntu64 | ok, but i need to reboot on debian an re-log me here, i'm on ubuntu. |
| 10:25.31 | *** join/#debian carandraug (~carandrau@proxy4.library.nuigalway.ie) |
| 10:25.47 | migbuntu64 | ok, you use KDE, it's rigth? |
| 10:25.52 | migbuntu64 | or lxde? |
| 10:25.56 | satish_ | i need help to set up a ad-hoc ipv6 network, please help.. |
| 10:25.58 | migbuntu64 | or openbox? |
| 10:26.43 | migbuntu64 | any way thank's a lot :D , see you on the reboot... |
| 10:27.23 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 10:27.36 | *** join/#debian buhman (~zack@unaffiliated/zjblabs) |
| 10:27.44 | buhman | how can I fix libreoffice theming? http://imagebin.org/index.php?mode=image&id=152479 |
| 10:28.07 | *** join/#debian happyhessian (~quassel@82.166.65.17) |
| 10:28.28 | migbuntu64 | dawud, no habia leido que hablas español :D, :D, gracias!!! |
| 10:29.08 | dawud | migbuntu64: ratpoison |
| 10:29.37 | migbuntu64 | me acabo de dar cuenta, no te extrañe que cometa errores ortograficos, entre el español, el italiano y el inglés me enrredo mucho :D |
| 10:30.12 | dawud | migbuntu64: no problem |
| 10:31.00 | *** mode/#debian [+l 1085] by debhelper |
| 10:31.17 | *** join/#debian sylar (~sylarrrr@bzq-218-182-227.red.bezeqint.net) |
| 10:31.50 | *** join/#debian Fyrespray (~Mark@78.32.255.161) |
| 10:31.59 | *** join/#debian Myztik (~Myztik@90-231-233-158-no109.tbcn.telia.com) |
| 10:32.11 | migbuntu64 | minimal, bueno, bueno... ;)) |
| 10:32.17 | migbuntu64 | reboot |
| 10:35.16 | *** join/#debian _thalamus (~thalamus@81-179-4-130.dsl.pipex.com) |
| 10:35.36 | *** join/#debian grazymax (~grazymax@host153-192-static.12-87-b.business.telecomitalia.it) |
| 10:36.50 | *** join/#debian martchukov (~antonm@algol.ru-spb-hm.net.martchukov.com) |
| 10:37.02 | *** join/#debian migdebian (~migdebian@ppp-140-26.28-151.libero.it) |
| 10:37.39 | *** join/#debian remoteCTRL1 (~kschinki@perseus.risc.uni-linz.ac.at) |
| 10:37.47 | nkuttler | hrm, how do i make the isc dhcpd use resolv.conf as domain name servers? |
| 10:38.37 | migdebian | hola, hola |
| 10:38.48 | migdebian | ahora soy migdebian :D |
| 10:39.05 | *** join/#debian MUILTFN (~MLINTH@adsl-98-80-230-109.mcn.bellsouth.net) |
| 10:39.22 | nkuttler | !es |
| 10:39.22 | dpkg | Este canal es de soporte tecnico en Ingles para Debian. Si prefiere que el soporte sea en espanol, por favor ingrese a #debian-es con /join #debian-es tecleado en la linea de chat. |
| 10:39.42 | *** join/#debian AbsintheSyringe (~havoc@conference/ubuntudevelopersummit/x-jbfgjywfrdmpmxyl) |
| 10:40.37 | *** join/#debian Rovanion (~Rovanion@h95-155-234-167.dynamic.se.alltele.net) |
| 10:41.00 | *** mode/#debian [+l 1092] by debhelper |
| 10:41.36 | migdebian | dpkg: thanks :D |
| 10:41.36 | dpkg | migdebian: my pleasure |
| 10:41.48 | migdebian | me too |
| 10:41.53 | buhman | dpkg: is pretty cool |
| 10:41.53 | dpkg | parse error: dunno what the heck you're talking about, buhman |
| 10:42.39 | dawud | migdebian: dpkg is a bot |
| 10:43.04 | buhman | dawud: he didn't have to know that :P |
| 10:43.06 | migdebian | ho!!! that's funy |
| 10:43.13 | migdebian | a bot!!! |
| 10:43.20 | migdebian | ok, any way |
| 10:43.27 | dawud | buhman: evil.... |
| 10:43.33 | dawud | :P |
| 10:44.13 | *** join/#debian jelly (~jelly@lan.iskon.hr) |
| 10:44.35 | *** join/#debian gnugr (~gnugr@athedsl-214168.home.otenet.gr) |
| 10:44.56 | migdebian | dawud: how did you now that the dpkg it's a bot? |
| 10:45.10 | dawud | migdebian: I'm a bot too |
| 10:46.15 | zcat[1] | !botabuse |
| 10:46.15 | dpkg | lay off me you buggerererers!!11! |
| 10:47.36 | migdebian | ok..., hummm, whait, i'm talking with a some kind of: "artificial intelligence", :D, :D very funy, i bet that you 're from the CIA |
| 10:47.39 | migdebian | :D |
| 10:47.42 | migdebian | :D |
| 10:47.50 | dawud | migdebian: NSA |
| 10:48.13 | *** join/#debian goose (~goose@well.i.made.ur-mom.go.honk-honk.org) |
| 10:50.08 | migdebian | whow!!! 8| , it's all rigth with me?, i mean, you see every thin i have on my pc i bet.. |
| 10:50.32 | dawud | migdebian: no. we bots are blind. |
| 10:50.35 | migdebian | also that i write on real time realy? |
| 10:50.46 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 10:51.13 | *** join/#debian MarKsaitis (~MarKsaiti@82.144.242.158) |
| 10:52.27 | migdebian | :D, very funy, you are grate, i don't remember my problem with debian anymore, you solved my problem in other ways, thank's :D, it's a pleasure, really |
| 10:52.39 | dawud | migdebian: time to work. Launch nautilus from command-line, don't background it and repro the error. See if it logs something useful |
| 10:52.51 | *** join/#debian AbsintheSyringe (~havoc@conference/ubuntudevelopersummit/x-nftixybuyuarhvru) |
| 10:53.14 | *** join/#debian EduardeCalibal (~Eduarde@novoseusadosinformatica.com.br) |
| 10:53.21 | dawud | migdebian: also, check if nautilus allow a verbosity or debug switch |
| 10:53.22 | buhman | wouldn't that be cool if #debian was at least partially composed of jeopardy-solving-quality bots that gave correct information 95+% of the time? |
| 10:53.44 | MeglaW | buhman: start programing, i´ll betatest it for you |
| 10:53.48 | migdebian | how can i do these check? |
| 10:54.03 | buhman | watson-dpkg :P |
| 10:54.05 | migdebian | on the output really? |
| 10:54.15 | dawud | buhman: I used to like megahal |
| 10:54.16 | *** join/#debian jrib (~jrib@upstream/dev/jrib) |
| 10:54.52 | dawud | migdebian: check the manpage, I don't really know, I'm not a gnome user |
| 10:55.37 | migdebian | like user, nautilus doesn't launch...., let me see , ok, i see the man page..., wait |
| 10:57.03 | *** join/#debian mastroWork (~Daniele@85-18-52-10.ip.fastwebnet.it) |
| 10:57.10 | migdebian | ok like root, bring me a several errors..., like: GConf error |
| 10:57.23 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 10:57.34 | *** join/#debian larsivi (~quassel@131-162-212.connect.netcom.no) |
| 10:57.45 | migdebian | triying to use pastebin site...wait |
| 10:58.00 | dawud | migdebian: you should be able to launch nautilus as a regular user |
| 10:59.00 | *** join/#debian PhoenixSTF (~PhoenixST@bl18-15-88.dsl.telepac.pt) |
| 11:00.54 | *** part/#debian gnugr (~gnugr@athedsl-214168.home.otenet.gr) |
| 11:01.29 | *** join/#debian nisse (~nisse@77.88.124.18) |
| 11:01.46 | *** join/#debian gnugr (~gnugr@athedsl-214168.home.otenet.gr) |
| 11:02.06 | nisse | Hi guys! How can I start an app on a different terminal than the one I'm at? I want this to be done at startup |
| 11:02.15 | *** join/#debian BlackFate (~asd@athedsl-377299.home.otenet.gr) |
| 11:02.15 | *** join/#debian BlackFate (~asd@unaffiliated/blackfate) |
| 11:02.17 | migdebian | http://pastebin.com/MLm7hbG3 |
| 11:03.01 | migdebian | no, i cant launch nautilus as regular user with a terminal... |
| 11:03.31 | migdebian | the output on a link was as a root user |
| 11:03.33 | *** join/#debian noonoooo (~noonoooo@ppp-202-136.98-62.inwind.it) |
| 11:04.22 | *** join/#debian choonming (~choonming@155.152.159.110.tm-hsbb.tm.net.my) |
| 11:04.32 | dawud | migdebian: please paste the output of running nautilus as a regular user inside a graphical session |
| 11:04.56 | buhman | how might I fix theming issues in libreoffice: http://imagebin.org/index.php?mode=image&id=152479 |
| 11:05.36 | *** join/#debian dpkg (~dpkg@unaffiliated/dpkg) |
| 11:06.43 | migdebian | ...the terminal doesn't bring me an output |
| 11:06.57 | migdebian | the output is blank |
| 11:07.38 | migdebian | input sintax: migdebian@debian:~$ nautilus |
| 11:07.59 | migdebian | output sintax: migdebian@debian:~$ |
| 11:08.16 | *** join/#debian ealdor (~ealdor@180.Red-79-156-131.staticIP.rima-tde.net) |
| 11:08.49 | themill | takes away migdebian's enter key |
| 11:10.10 | migdebian_ | what's mean these: "themill takes migdebian's enter key" on the chat? |
| 11:11.28 | ectospasm | migdebian_: don't use the Enter key as punctuation |
| 11:11.35 | migdebian_ | hey!!! my prefered bot..., are you there? |
| 11:11.50 | migdebian_ | what's mean? |
| 11:12.17 | migdebian_ | what's mean? ectospasm |
| 11:12.42 | nisse | how can I redirect input from a terminal to an app? |
| 11:12.52 | MeglaW | migdebian_: he means your lines are verry short. |
| 11:12.57 | nisse | running in a different terminal.. |
| 11:13.25 | *** join/#debian a111 (~a111a111@78.150.236.144) |
| 11:13.26 | migdebian_ | ah, you mean exclamation and these thinks |
| 11:13.30 | *** join/#debian larsivi (~quassel@131-162-212.connect.netcom.no) |
| 11:15.12 | *** join/#debian robertdavid (~Robert@217.169.177.82) |
| 11:15.17 | migdebian_ | verry short? i'm loose |
| 11:15.37 | migdebian_ | i don't understand, i'm so sorry :( |
| 11:15.59 | ectospasm | !tell migdebian_ about ask |
| 11:16.33 | migdebian_ | thank's for all guys , i'm living |
| 11:17.05 | ectospasm | I don't think "living" means what he meant. |
| 11:17.36 | *** join/#debian davidisko (~davidisko@gw1.contineo.sk) |
| 11:18.08 | *** join/#debian Sulimo (~angel@host148-236-dynamic.6-87-r.retail.telecomitalia.it) |
| 11:18.32 | atypic | No. |
| 11:19.49 | *** join/#debian beli (a0556846@gateway/web/freenode/ip.160.85.104.70) |
| 11:19.50 | *** join/#debian harobed_ (~harobed@pda57-1-82-231-115-1.fbx.proxad.net) |
| 11:19.55 | ectospasm | are there language-specific channels for debian, like ubuntu has? |
| 11:21.01 | MartyD | ectospasm: http://wiki.debian.org/IRC |
| 11:21.10 | *** join/#debian abrotman (~abrotman@pdpc/supporter/active/abrotman) |
| 11:22.15 | dawud | he meant 'leaving' |
| 11:22.19 | themill | ectospasm: there are, and migdebian was pointed towards them more than once. |
| 11:22.49 | ectospasm | OK, thanks. |
| 11:23.40 | *** part/#debian cosmodad (~treimann@unaffiliated/cosmodad) |
| 11:30.47 | *** join/#debian Glebelg (~Glebelg@unaffiliated/glebelg) |
| 11:34.26 | *** join/#debian RoozbehOnline (~rosha@91.99.232.104) |
| 11:36.22 | *** join/#debian Guest80968 (~mentor@unaffiliated/mentor) |
| 11:36.46 | *** join/#debian Guest63747 (~Unix@nat/hp/x-ssyhnvsbvqzmnfev) |
| 11:39.27 | *** join/#debian smaug91 (~smaug9@cpe-67-249-206-127.twcny.res.rr.com) |
| 11:39.39 | *** join/#debian phogg (~phogg@173-10-190-217-BusName-washingtonDC.hfc.comcastbusiness.net) |
| 11:40.09 | *** join/#debian HazardX (~HazardX3@pool-96-237-60-90.bstnma.fios.verizon.net) |
| 11:41.49 | *** join/#debian dubbaluga (c3ca9001@gateway/web/freenode/ip.195.202.144.1) |
| 11:41.50 | *** join/#debian bofur (~bofur@85.223.26.74) |
| 11:42.52 | *** join/#debian MUILTFN (~MLINTH@adsl-98-80-230-109.mcn.bellsouth.net) |
| 11:45.02 | *** join/#debian shahri (~shahri@dslb-188-109-032-238.pools.arcor-ip.net) |
| 11:45.24 | *** join/#debian g0bl1n (~g0bl1n@unaffiliated/g0bl1n) |
| 11:45.55 | *** join/#debian Gottaname (~Gottaname@bb116-15-183-47.singnet.com.sg) |
| 11:46.57 | *** join/#debian superjet_busy (~superjet@wikimedia/Crewlay) |
| 11:47.10 | *** join/#debian lanthan (~ze@p50992b91.dip0.t-ipconnect.de) |
| 11:48.57 | *** join/#debian desti (~desti@dslb-092-072-210-135.pools.arcor-ip.net) |
| 11:49.24 | dawud | in my sources.list I have a line for security updates pointing to squeeze/updates main contrib non-free, however, in http://lists.debian.org/debian-volatile-announce/2011/msg00000.html the repo for updates (new volatile) is squeeze-updates main. Are they the same repo or I'm confusing things? |
| 11:50.01 | dawud | s/I'm/am I/ |
| 11:51.00 | *** mode/#debian [+l 1100] by debhelper |
| 11:52.24 | streuner | dpkg, volatile |
| 11:52.24 | dpkg | Squeeze users, ask me about <squeeze volatile>. Debian Volatile is a project that aims at keeping the <oldstable> distribution up to date for fast moving packages such as virus scanners, spam scanners and firmware downloaders. An example line for your lenny sources.list is: deb http://volatile.debian.org/debian-volatile lenny/volatile main contrib non-free See also <volatile mirrors>. http://www.debian.org/volatile/ |
| 11:52.53 | streuner | dpkg, squeeze volatile |
| 11:52.53 | dpkg | The Debian <Volatile> archive is discontinued starting from Debian 6.0, replaced by the squeeze-updates suite on official mirrors. Your squeeze sources.list could have "deb http://cdn.debian.net/debian/ squeeze-updates main contrib non-free". http://www.debian.org/News/2011/20110215 http://wiki.debian.org/StableUpdates . Not to be confused with <squeeze/updates>, ask me about <security>. |
| 11:53.47 | dawud | streuner: thanks |
| 11:56.16 | *** join/#debian qwe (~qwe@51.111-229-46.telenet.ru) |
| 11:56.21 | *** join/#debian isidore (~quassel@85.26.76.226) |
| 11:57.38 | qwe | hi, has anyone used debian.iso with YUMI (USB-stick) ??? |
| 11:57.53 | *** join/#debian xlotlu (~john@86.121.76.140) |
| 11:58.54 | *** join/#debian Tuxist (~quassel@dyndsl-031-150-009-070.ewe-ip-backbone.de) |
| 11:59.41 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 12:00.07 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-hqdkkgjqicsbzuoc) |
| 12:00.13 | *** join/#debian vagn (~vagn@c-24-60-245-97.hsd1.ma.comcast.net) |
| 12:00.23 | vagn | mcollective |
| 12:01.25 | *** join/#debian prem (~prem@218.248.24.19) |
| 12:03.05 | prem | hi.,adding a new user from "USers and Groups" always shows "Account is disabled" for me |
| 12:03.16 | prem | it was workign fine before and this happens after few upgrades in my machine., |
| 12:03.39 | *** join/#debian hele (~hele@cs181225139.pp.htv.fi) |
| 12:04.11 | *** join/#debian MrOpposite (~mropposit@unaffiliated/mropposite) |
| 12:05.04 | *** join/#debian Multiply (~Multiply@unaffiliated/multiply) |
| 12:05.26 | *** join/#debian salvin (~salvin@unaffiliated/salvin) |
| 12:06.08 | *** join/#debian kellyh (~kelly@5e02d647.bb.sky.com) |
| 12:06.46 | *** join/#debian isidore_ (~quassel@85.26.76.226) |
| 12:08.10 | *** join/#debian Qtronix (qtronix@186.84-49-116.nextgentel.com) |
| 12:09.57 | *** join/#debian Kraken (~kraken@a89-153-49-195.cpe.netcabo.pt) |
| 12:10.39 | *** join/#debian xakz (~XaMaD@ARennes-554-1-203-5.w92-158.abo.wanadoo.fr) |
| 12:11.00 | *** mode/#debian [+l 1109] by debhelper |
| 12:11.08 | *** join/#debian garulf (~garulf@host245-110-dynamic.7-87-r.retail.telecomitalia.it) |
| 12:11.30 | garulf | hi guys, i've some problem with ddrescuing from an hd |
| 12:11.51 | qwe | oh really ? |
| 12:11.52 | garulf | i use a file for recovery at first time, something like ddrescue /dev/sdb1 file1 logfile |
| 12:12.01 | garulf | qwe, give me time :) |
| 12:12.29 | garulf | then, when not all data was recovedered i dd the file on an hd |
| 12:12.34 | *** join/#debian xakz (~XaMaD@ARennes-554-1-203-5.w92-158.abo.wanadoo.fr) |
| 12:12.47 | garulf | i create new partition table on the hd, then dd file1 /dev/sdc1 |
| 12:13.03 | garulf | then i continue ddrescuing with ddrescue /dev/sdb1 /dev/sdc1 logfile |
| 12:13.06 | *** join/#debian ICEBreakPoint (~d3mux32@89.181.150.107) |
| 12:13.28 | *** join/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 12:13.41 | garulf | the hd is 500gb but now that recovered data are about 250 gb ddrescue stop working, saying that there isn't space left on device.. |
| 12:13.51 | *** join/#debian Glebelg (~Glebelg@unaffiliated/glebelg) |
| 12:14.25 | *** join/#debian paquin (~paquin@2001:470:26:4e::dead:feed) |
| 12:14.36 | garulf | any ideas? |
| 12:14.39 | qwe | garulf: what say "df -a" ? |
| 12:14.56 | qwe | *df -ah |
| 12:14.57 | garulf | used at 24% |
| 12:15.18 | qwe | and 500 gb ? |
| 12:15.28 | garulf | yes |
| 12:15.35 | garulf | well---466 |
| 12:15.56 | garulf | size 466gb used 109gb aval 389gb |
| 12:16.07 | *** join/#debian Internat (~nf@123-243-184-161.static.tpgi.com.au) |
| 12:16.22 | *** join/#debian twinkie_addict (~twinkie@adsl-216-78-223-47.sdf.bellsouth.net) |
| 12:16.34 | twinkie_addict | hi |
| 12:16.36 | garulf | i'm thinking that dding the uncomplete recovery file on the devile file missed up things |
| 12:16.56 | garulf | device* |
| 12:17.07 | yagoo | garulf, ? |
| 12:17.14 | yagoo | calls Nick Burns for garulf |
| 12:17.22 | qwe | garulf: try new drive |
| 12:17.39 | garulf | yagoo, what's the problem yagoo? |
| 12:17.55 | yagoo | garulf, move! |
| 12:18.00 | yagoo | lol |
| 12:18.12 | *** join/#debian mastroDani (~Daniele@85-18-52-10.ip.fastwebnet.it) |
| 12:19.09 | garulf | qwe, i don't think is a drive problem, thank you btw |
| 12:19.28 | qwe | garulf: try "-v" |
| 12:19.37 | qwe | with ddrescue |
| 12:19.55 | qwe | and look at space on device |
| 12:22.22 | *** join/#debian khaard (~khaard@87-206-165-44.dynamic.chello.pl) |
| 12:22.36 | garulf | qwe, it says nothing about space on device, only that it doesn't Sparse the file |
| 12:23.37 | *** join/#debian starenka (~starenka@m229.dkm.cz) |
| 12:23.51 | *** join/#debian DimitryKakadu (~DimitryKa@217.71.235.218) |
| 12:25.01 | *** join/#debian GinTonic (darmen@218.72.34.88) |
| 12:25.26 | *** join/#debian aLgEBrA (~holger@p2-009.pptp.ggew-net.de) |
| 12:26.38 | *** join/#debian gremset (ubuntu@117.192.123.16) |
| 12:27.47 | ali3n0 | hi guys, anyone here did set up an IPv6 router? |
| 12:28.04 | *** join/#debian SLot (~SLot@unaffiliated/slot) |
| 12:28.08 | qwe | garulf: file is damaged |
| 12:28.27 | *** join/#debian tempeldirne (~L@gssn-5f7575c0.pool.mediaWays.net) |
| 12:28.59 | qwe | ali3n0: any trouble? |
| 12:29.34 | beli | ali3n0: with debian? what do you mean? |
| 12:29.40 | *** join/#debian Anon1827_ (~Anonymous@220-244-107-61.static.tpgi.com.au) |
| 12:29.45 | ali3n0 | qwe, seems I'm not able to route packets through my squeeze box. or better, seems that pings flow correctly outbound, but once back they get discarded |
| 12:29.52 | ali3n0 | http://paste.lopsa.org/paste |
| 12:29.59 | *** join/#debian r4co0n_ (c25fc5f4@78.129.202.38) |
| 12:30.01 | ali3n0 | sorry: http://paste.lopsa.org/106 |
| 12:30.14 | *** join/#debian peppe (~peppe@unaffiliated/peppe) |
| 12:30.53 | ali3n0 | I've already set net.ipv6.conf.all.forwarding=1 |
| 12:31.00 | *** mode/#debian [+l 1118] by debhelper |
| 12:31.09 | justin_ | ali3n0: are you running radvd? |
| 12:31.24 | ali3n0 | justin_, no |
| 12:31.51 | garulf | qwe, i will try to store to an image file rather direct to the partition, thank you |
| 12:32.08 | ali3n0 | justin_, I didn't find it mentioned anywhere. is it mandatory to get routing work?? |
| 12:33.21 | justin_ | ali3n0: you have some more reading to do |
| 12:33.47 | ali3n0 | justin_, debian's wiki is quite poor about the topic, any suggestion is appreciated ;) |
| 12:33.59 | justin_ | ali3n0: just about any ipv6 guide should do |
| 12:34.22 | ali3n0 | for instance I've followed this one: http://fermiparadox.wordpress.com/2007/02/04/configuring-an-ipv6-gateway-with-debian/ |
| 12:34.56 | justin_ | ali3n0: read the last sentence |
| 12:35.08 | garulf | qwe, i think i found the problem, partition table of receving drive is messed up. |
| 12:35.22 | *** join/#debian kanneblei (~lucas@189.61.246.197) |
| 12:35.24 | *** join/#debian puty3 (~administr@159.178.216.87.static.jazztel.es) |
| 12:35.29 | *** join/#debian rickbol (~rickbol@cpe-174-096-213-166.carolina.res.rr.com) |
| 12:35.30 | puty3 | . |
| 12:35.39 | garulf | qwe, fdisk and df recognizes 500gb, but gparted only 232 and doesn't recognize fstype either |
| 12:35.52 | ali3n0 | yes, but he talks about "configure an IPv6 address for ever host in the network". I've got IPv6 addresses ok for any interface, I can ping hosts correctly |
| 12:36.06 | ali3n0 | anyway, thanks for the hint |
| 12:36.34 | justin_ | ali3n0: uh, he says "so you do not need to configure an IPv6 address for ever host in the network" |
| 12:36.46 | justin_ | "not need to" being the key words there |
| 12:36.57 | *** join/#debian Touma (~Touma@190.202.88.164) |
| 12:37.02 | *** join/#debian anisfarhana (~anis@unaffiliated/anisx) |
| 12:37.20 | ali3n0 | justin_, got it. But, as I said, I've got addresses ok already |
| 12:38.16 | *** join/#debian T-One (~T-One@194.183.141.242) |
| 12:39.27 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-magzgepvrexrpcik) |
| 12:41.51 | puty3 | hi i have a external hdd. seems to be full but i can't remove files in trash. how is a sintaxis to delete this files if dir is no empty? rmdir ? thanks |
| 12:42.03 | *** part/#debian BWMerlin (~BW~Merlin@CPE-60-226-105-114.qld.bigpond.net.au) |
| 12:42.07 | *** join/#debian eshat (~eshat@2001:638:504:c018:226:2dff:fef6:1d80) |
| 12:42.54 | r4co0n_ | puty3: rm -rf should do the job, but be careful, it works recursively and forces the delete. |
| 12:43.20 | abrotman | wtf .. that's unnecessary |
| 12:43.50 | r4co0n_ | sry, this is how i delete stuff i know i want deleted... |
| 12:44.04 | justin_ | it's also how you delete stuff you didn't know you want deleted |
| 12:44.25 | *** part/#debian Nebukadneza (~Nebukadne@h1749472.stratoserver.net) |
| 12:44.39 | r4co0n_ | if you are unable to determine the contents of said point of deletion |
| 12:44.59 | *** join/#debian rhineshell (~chris@mail.pawisda.de) |
| 12:45.00 | abrotman | r4co0n_: it's a dumb command that let's people shoot themselves in the foot |
| 12:45.19 | r4co0n_ | well, another solution? |
| 12:45.22 | abrotman | use smarter commands .. not the brutal one |
| 12:45.25 | r4co0n_ | its my os, not my nanny |
| 12:45.34 | puty3 | rmdir: invalid option -- 'r' |
| 12:45.55 | r4co0n_ | suggestions? |
| 12:46.07 | atypic | puty3: not rmdir. rm. |
| 12:46.24 | justin_ | puty3: aren't you using gnome or something? why don't you just click on a file and hit delete? |
| 12:46.52 | puty3 | i'am trying delete it over mc but i would know also terminal solution |
| 12:47.06 | r4co0n_ | he cannot use trash, as partition is full?! |
| 12:47.22 | justin_ | you don't have to use the trash !?!? |
| 12:47.28 | puty3 | justin_ becource i when i delete some copy create |
| 12:47.29 | twinkie_addict | mc menu over to deleate and hit enter |
| 12:47.36 | r4co0n_ | never stumbled upon that, dunno |
| 12:47.39 | twinkie_addict | delete\ |
| 12:47.51 | puty3 | i am doing it with mc |
| 12:48.45 | puty3 | mc with F8 seems to work well |
| 12:49.00 | puty3 | i'am going to try delete\ |
| 12:49.13 | *** join/#debian Reiko2 (~Reiko2@pd95bdd86.dip0.t-ipconnect.de) |
| 12:49.19 | puty3 | i would to know terminal command |
| 12:49.48 | r4co0n_ | terminal command for deletion is "rm", check the man pages... |
| 12:50.41 | *** join/#debian ddan (~dan@host194-255-dynamic.6-87-r.retail.telecomitalia.it) |
| 12:50.41 | puty3 | yes i know, but rmdir -rf dosent work |
| 12:50.51 | beli | puty3: rm |
| 12:50.55 | beli | rm is not rmdir |
| 12:51.26 | DocChauncey | rm -ri * ? |
| 12:51.27 | puty3 | beli and if i want to delete directory? |
| 12:51.58 | puty3 | DocChauncey thanks i will try |
| 12:51.58 | DocChauncey | -r |
| 12:51.59 | beli | puty3: rm can delete files.....and on linux anything is file based...also directories...so you can delete files AND directories with rm |
| 12:52.14 | beli | puty3: but why not just read the manual?+ |
| 12:52.21 | r4co0n_ | +1 |
| 12:52.57 | *** join/#debian lneely (~lneely@150.200.42.158) |
| 12:53.03 | puty3 | ok ok iam on it xd dont kill me pls thanks |
| 12:53.10 | *** join/#debian zamberlan (~zamberlan@201-2-29-34.pvoce702.dsl.brasiltelecom.net.br) |
| 12:53.16 | abrotman | shakes his head ... |
| 12:53.23 | DocChauncey | rm with globs can kill you if you aren't careful |
| 12:53.45 | r4co0n_ | I learned this one when reading bofh... |
| 12:53.50 | *** join/#debian webad_13 (~milos@193.205.17.135) |
| 12:53.58 | abrotman | shocker |
| 12:54.08 | r4co0n_ | im young |
| 12:54.09 | twinkie_addict | lol same here |
| 12:54.20 | webad_13 | when I try to change console resolution to my native resolution using fbset I get: ioctl FBIOPUT_VSCREENINFO: Invalid argument |
| 12:54.22 | twinkie_addict | bofh rocks |
| 12:54.43 | jelly | webad_13: are you root? |
| 12:54.47 | webad_13 | any clue about the error - I also tried changing it in grub with video= but it disregards the change |
| 12:55.00 | webad_13 | jelly, with sudo |
| 12:55.05 | r4co0n_ | twinkie_addict: getting ot, check out the new stuff at theregister.co.uk under odds&sods->bofh |
| 12:55.24 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 12:55.32 | jelly | webad_13: some fb drivers just don't support resolution changes |
| 12:55.43 | atypic | abrotman: I have this weird need to put my hand on my forehead... |
| 12:55.57 | *** join/#debian acemi (~acemi@unaffiliated/acemi) |
| 12:56.01 | abrotman | better than my thought. .. |
| 12:56.02 | *** join/#debian TomFarr (~tomfarr@broadband-95-84-169-84.nationalcablenetworks.ru) |
| 12:56.06 | twinkie_addict | thats where i go to catch up on things lol |
| 12:56.31 | twinkie_addict | been reading bofh since slackware 9 |
| 12:56.53 | r4co0n_ | off-topic, pm or stop pls :) |
| 12:57.05 | twinkie_addict | oop mandrake 9.1 |
| 12:57.05 | webad_13 | jelly, I have intel 82G35 Express integrated |
| 12:57.16 | twinkie_addict | sorry booboo |
| 12:57.17 | webad_13 | do you think there is a driver for fb that works with it |
| 12:57.20 | *** join/#debian bambi33 (~mIRCGFind@95.234.173.141) |
| 12:57.57 | *** join/#debian babilen (~babilen@unaffiliated/babilen) |
| 12:58.20 | *** join/#debian Mulvane (~mulvane@unaffiliated/mulvane) |
| 12:58.29 | justin_ | webad_13: I'm sure X works with it just fine |
| 12:58.54 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 12:58.55 | *** join/#debian xiangfu (~xiangfu@fidelio.qi-hardware.com) |
| 12:58.56 | *** join/#debian CarlosEspa (~ircap@77.208.129.11) |
| 12:58.57 | webad_13 | that is true, it does with xranr I change the resolution just fine |
| 12:59.09 | jelly | use X, then, eh |
| 12:59.11 | webad_13 | that is why I was thinking that it might work here as well |
| 12:59.27 | *** join/#debian RA3OR (angel@188.214.222.57) |
| 12:59.50 | webad_13 | jelly: yeah it is an option, but I am really trying to make it work with framebuffer |
| 13:00.03 | *** join/#debian Kevin` (~kevin@nelson.kwzs.be) |
| 13:00.26 | jelly | it's not worth the time IME |
| 13:00.50 | Mulvane | My penis is above average size for this channel. |
| 13:00.51 | *** part/#debian Mulvane (~mulvane@unaffiliated/mulvane) |
| 13:01.11 | jelly | unless you're very very low on RAM and can't afford even the most reduced X session |
| 13:02.10 | webad_13 | jelly: I am not low on ram really, but I can use every bit of ram - for the calculations that I make |
| 13:02.35 | webad_13 | and since this session becomes quite long, I wanted to have proper resolution - but the one I have now is not too bad |
| 13:03.05 | webad_13 | I was thinking though that because grub starts in different resolution and then I have resolution change, that I will be able to change to my native resolution |
| 13:03.35 | starenka | hi, im having problems w/ no sound. in kmix i see dummy output, running mplayer as root shows this http://openpaste.org/en/27550/ |
| 13:03.36 | starenka | any clue? |
| 13:03.42 | starenka | thanks for any idea |
| 13:03.48 | starenka | (im on testing) |
| 13:04.18 | *** join/#debian slvmchn (~slvmecha@c-24-91-117-140.hsd1.ma.comcast.net) |
| 13:04.21 | bzed | the first clue is: never run mplayer as root, you never know which buggy stuff is hidden between codecs and stuff |
| 13:04.22 | *** join/#debian Rill (~Rill@adslc3e44ff4.fixip.t-online.hu) |
| 13:04.53 | starenka | bzed: well it does pretty the same as user, it was just quick "am i in audio group" test |
| 13:04.56 | starenka | (i am) |
| 13:05.16 | bzed | starenka: well the output tells your problem: something else is using your sound device |
| 13:05.29 | bzed | starenka: (and your sound device is not able to handle several sources at once) |
| 13:05.36 | bzed | !dmix |
| 13:05.37 | dpkg | dmix is an <ALSA> subsystem which allows an audio device to play multiple sound streams simultaneously without the need for an external sound server. See http://alsa.opensrc.org/Dmix for more information. A sample asound.conf is at http://img.hexus.net/v2/features/foss/a3/images/asound.conf |
| 13:05.40 | bzed | starenka: ^ |
| 13:06.10 | starenka | hm, thanks. how can i determine what's using the card anyway? |
| 13:06.11 | ali3n0 | justin_, just for the records, turned out that radvd wasn't needed, it was jist a wrong line in the routing table. thanks for your help btw |
| 13:06.18 | *** join/#debian onosendai (~onosendai@unaffiliated/onosendai) |
| 13:06.20 | justin_ | ali3n0: if you say so |
| 13:06.53 | *** part/#debian zamberlan (~zamberlan@201-2-29-34.pvoce702.dsl.brasiltelecom.net.br) |
| 13:07.12 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-apvhbtxfavwdlpce) |
| 13:07.27 | themill | starenka: /msg dpkg list alsa users |
| 13:08.13 | starenka | themill: hmm, how? |
| 13:08.42 | themill | dpkg: tell starenka about list alsa users |
| 13:08.57 | *** join/#debian PsyTrance (doam@gateway/shell/bshellz.net/x-bigfikpfhleytpnl) |
| 13:09.10 | themill | starenka: dpkg is a bot; he just sent you a private message. It will have opened up in a new tab. |
| 13:09.38 | ali3n0 | justin_, I've read docs and radvd is meant for stateless autoconfiguration. I've already got an ipv6 subnet (/48) and I needed a box to route packets, not to assign addresses |
| 13:09.46 | *** join/#debian ring0 (~ring0@unaffiliated/ring0) |
| 13:09.49 | starenka | oh, i was like... how can i list this via dpkg :D |
| 13:09.50 | starenka | rhanks |
| 13:11.10 | justin_ | ali3n0: if you say so |
| 13:11.12 | *** join/#debian InertNimbleMage (~trentg@pdpc/supporter/active/trentg) |
| 13:11.39 | *** join/#debian DammitJim (~Elive_use@99-75-56-77.lightspeed.dybhfl.sbcglobal.net) |
| 13:12.23 | *** part/#debian TomFarr (~tomfarr@broadband-95-84-169-84.nationalcablenetworks.ru) |
| 13:12.52 | *** join/#debian ineiros (~itniemin@james.ics.hut.fi) |
| 13:13.48 | *** join/#debian coolmadmax (~cool_code@client-203-166-108-5.net2000.com.au) |
| 13:14.18 | *** join/#debian Soul_Eater (~marcelo@unaffiliated/soul-eater/x-4649632) |
| 13:15.07 | *** join/#debian babilen (~babilen@unaffiliated/babilen) |
| 13:15.24 | *** join/#debian Cain` (~Geek@unaffiliated/cain) |
| 13:16.15 | starenka | themill: hmm http://openpaste.org/en/27551/ |
| 13:16.35 | starenka | ouch.. sorry http://openpaste.org/en/27552/ |
| 13:18.41 | starenka | ok, so it was speech-dispatcher |
| 13:19.41 | *** join/#debian _thalamus (~thalamus@81-179-4-130.dsl.pipex.com) |
| 13:19.55 | starenka | thank you. have a nice day |
| 13:20.07 | *** join/#debian dvs (~me@206.248.136.46) |
| 13:25.07 | *** join/#debian ICEBreakPoint (~d3mux32@89-181-155-209.net.novis.pt) |
| 13:25.27 | *** join/#debian zippy (~zuppy@xdsl-92-252-86-199.dip.osnanet.de) |
| 13:26.09 | *** join/#debian ksheurs (~sheursk@nyv-exweb.iac.com) |
| 13:28.38 | *** part/#debian delYsid (~user@chello084115136207.3.graz.surfer.at) |
| 13:28.42 | *** join/#debian dajhorn (~dajhorn@adsl-75-17-126-238.dsl.rcsntx.sbcglobal.net) |
| 13:29.12 | *** join/#debian janis (~jeffry@46.103.176.121) |
| 13:30.02 | janis | hi guys, which kernel does the installer use? I am installing to the hp pavilion dv6 which requires quite a recent one |
| 13:30.12 | *** part/#debian sjoerd (~sjoerd@tunnel3460.ipv6.xs4all.nl) |
| 13:30.22 | dvs | janis: 2.6.32-5 |
| 13:31.04 | janis | is there an alternative rescue cd you recomment with more recent ones? |
| 13:31.44 | dvs | janis: Maybe the weekly build |
| 13:31.51 | *** join/#debian rr (c1b3a013@gateway/web/freenode/ip.193.179.160.19) |
| 13:33.25 | janis | i located the corresponding weekly build.. how do i find the kernel version it uses? |
| 13:34.01 | aguitel_ | anyone are using myphotoalbum.com service ? |
| 13:34.08 | *** join/#debian webad_13 (~milos@193.205.17.135) |
| 13:34.23 | webad_13 | how can I display a list of my drivers? |
| 13:34.25 | dvs | ,kernels |
| 13:34.26 | treebeen | aguitel_: no, i don't use "services", i don't want my stuff on foreign servers |
| 13:34.28 | judd | Available kernel versions are: experimental: 2.6.39-rc5-686-pae (2.6.39~rc5-1~experimental.1); sid: 2.6.38-2-686 (2.6.38-5); wheezy: 2.6.38-2-686 (2.6.38-3); squeeze-backports: 2.6.38-bpo.2-686 (2.6.38-3~bpo60+1); squeeze: 2.6.32-5-686 (2.6.32-31); lenny-backports: 2.6.32-bpo.5-686 (2.6.32-30~bpo50+1); lenny: 2.6.26-2-686 (2.6.26-26lenny2) |
| 13:34.41 | dvs | It looks like 2.6.38 |
| 13:34.59 | janis | thanks guys! i'll try with it! |
| 13:35.39 | *** join/#debian Floops (~baihu@shellium/staff/floops) |
| 13:36.00 | treebeen | ah, backports has 2.6.38, hmm |
| 13:36.38 | *** join/#debian Rziz (~calvin@ip5450a059.adsl-surfen.hetnet.nl) |
| 13:38.37 | *** join/#debian foetus (~norbi@dslb-178-005-115-140.pools.arcor-ip.net) |
| 13:39.06 | *** join/#debian sacredchao (debian-tor@gateway/tor-sasl/nike) |
| 13:44.44 | *** join/#debian hell_razer (~HellRaise@196-175-179-94.pool.ukrtel.net) |
| 13:44.57 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 13:45.15 | dawud | linux-headers-2.6.38-bpo.2-686-bigmem depends on linux-kbuild-2.6.38, not available in backports, any hints? |
| 13:47.00 | *** join/#debian gusnan (~gusnan@h114n7c1o269.bredband.skanova.com) |
| 13:47.49 | *** join/#debian return13 (~return13@ux-2800.inf.fh-bonn-rhein-sieg.de) |
| 13:48.09 | *** join/#debian poisonbit (~poisonbit@85.219.69.139.dyn.user.ono.com) |
| 13:49.06 | treebeen | ,versions chromium |
| 13:49.06 | judd | Package chromium on i386 -- lenny: 0.9.13.2-1; squeeze: 0.9.14.1-2; sid: 10.0.648.205~r81283-1 |
| 13:49.32 | treebeen | ,versions chromium-browser |
| 13:49.35 | judd | Package chromium-browser on i386 -- squeeze: 6.0.472.63~r59945-5+squeeze4; squeeze-security: 6.0.472.63~r59945-5+squeeze4; wheezy: 6.0.472.63~r59945-5+squeeze4; sid: 10.0.648.205~r81283-1 |
| 13:50.06 | treebeen | i wonder when 10 will get into testing, hmm |
| 13:50.36 | *** join/#debian Garda (~Garda@r180-216-12-64.cpe.vividwireless.net.au) |
| 13:51.17 | *** join/#debian Zekah (~Zekah@2a01:e0b:1:143:62eb:69ff:fe8f:17d6) |
| 13:52.14 | *** join/#debian waterloo2005 (~huxpeng@60.168.85.155) |
| 13:54.13 | *** join/#debian s0d0 (~sod@host81-141-48-65.wlms-broadband.com) |
| 13:59.45 | *** join/#debian muneeb (~muneeb@123.237.70.69) |
| 14:00.14 | *** join/#debian dougvann (~chatzilla@c-67-162-38-213.hsd1.in.comcast.net) |
| 14:00.51 | *** join/#debian RobinJ (~Robin@109.132.199.55) |
| 14:00.51 | *** join/#debian RobinJ (~Robin@unaffiliated/robinj) |
| 14:01.42 | *** join/#debian Morten_ (~morten@2.107.15.157) |
| 14:02.23 | *** join/#debian bier|tp (~bier@p54A5ABF3.dip.t-dialin.net) |
| 14:02.48 | *** join/#debian Jurkki (~jukka@a91-156-171-13.elisa-laajakaista.fi) |
| 14:03.36 | *** join/#debian bier (~bier@p54A5ABF3.dip.t-dialin.net) |
| 14:03.48 | *** join/#debian m4ggus (~m4ggus@93.213.63.19) |
| 14:04.15 | *** join/#debian meeso (~meeso@fw-delk.nationalnet.com) |
| 14:07.03 | *** join/#debian buscon (~buscon@pd95cdc79.dip0.t-ipconnect.de) |
| 14:07.03 | *** join/#debian AbsintheSyringe (~havoc@conference/ubuntudevelopersummit/x-svfqjdwhdeeywmxo) |
| 14:07.31 | *** join/#debian zippy (~zuppy@xdsl-92-252-86-199.dip.osnanet.de) |
| 14:07.33 | *** join/#debian ellisgeek (~ellisgeel@66-190-33-174.dhcp.fdul.wi.charter.com) |
| 14:08.07 | *** join/#debian webad_13 (~milos@193.205.17.135) |
| 14:09.14 | webad_13 | how do I add modes to /sys/class/drm/card0-VGA-1/modes... that is resolutions. My native resolution is not within these modes |
| 14:09.22 | webad_13 | I am using framebuffer - no x |
| 14:09.24 | webad_13 | in tty |
| 14:09.45 | pipeline | webad_13: you are probably using an intel system that requires a BIOS patch |
| 14:09.55 | webad_13 | yep it is intel |
| 14:10.09 | pipeline | webad_13: at one time, this would have been done at boot with a tool called "i915resolution." I don't know if that package still exists in debian, but there is some kind of package along those lines. Google is your buddy. |
| 14:10.09 | webad_13 | is it a common problem? |
| 14:10.13 | *** join/#debian pistolpete (~pistolpet@p57ACFBC3.dip.t-dialin.net) |
| 14:10.17 | pipeline | webad_13: the BIOS patching has to be done on every boot, it's never permanent |
| 14:10.34 | pipeline | webad_13: it's not a problem, exactly. It's just the design of the damn thing. |
| 14:10.51 | *** join/#debian greentea (~greentea@c-24-125-178-151.hsd1.va.comcast.net) |
| 14:10.54 | pipeline | webad_13: it comes with some basic VESA-esque modes preconfigured in the firmware, and your OS has to be smart enough to patch the firmware if it wants to do more than that |
| 14:10.55 | webad_13 | i c, ok i'll google it - thank you |
| 14:11.09 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-iwtvpxdylcpvasro) |
| 14:11.10 | pipeline | webad_13: that said, framebuffer is essentially a dead-end. I wouldn't count on ever getting this working in the age of kernel mode setting. |
| 14:11.27 | *** join/#debian greentea (~greentea@c-24-125-178-151.hsd1.va.comcast.net) |
| 14:11.42 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-lenmfvcjupmotevg) |
| 14:12.18 | *** join/#debian shingouz (shingouz@80-186-56-190.elisa-mobile.fi) |
| 14:12.25 | webad_13 | pipeline, the thing is on the other machine (portable hdd) it works without problem - why do you say it is a dead end? |
| 14:13.34 | pipeline | webad_13: it's not widely used and afaik no one is working on it anymore. |
| 14:14.24 | *** join/#debian muneeb (~muneeb@118.95.71.37) |
| 14:16.09 | *** join/#debian Reiko2 (~Reiko2@pd95bdd86.dip0.t-ipconnect.de) |
| 14:18.44 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 14:20.09 | *** join/#debian semprix (~semprix@unaffiliated/semprix) |
| 14:20.32 | *** join/#debian llua (~llua@unaffiliated/llua) |
| 14:20.39 | *** join/#debian cafaro (~cafaro@92.254.14.102) |
| 14:20.39 | *** join/#debian cafaro (~cafaro@unaffiliated/cafaro) |
| 14:21.00 | *** mode/#debian [+l 1126] by debhelper |
| 14:21.32 | *** join/#debian hell_razer (~HellRaise@196-175-179-94.pool.ukrtel.net) |
| 14:23.00 | *** join/#debian assurbanipal (~quassel@adsl-138.109.242.155.tellas.gr) |
| 14:24.31 | *** join/#debian nixoeen (~nixoeen@unaffiliated/nixoeen) |
| 14:25.37 | *** join/#debian PhoenixSTF (~PhoenixST@87.196.247.36) |
| 14:27.10 | *** join/#debian Zitter (~danilo@host223-47-dynamic.16-79-r.retail.telecomitalia.it) |
| 14:27.27 | *** join/#debian mastroWork (~Daniele@85-18-52-10.ip.fastwebnet.it) |
| 14:28.09 | *** join/#debian ppradhan (~Adium@nagarkot.ddns.uark.edu) |
| 14:28.41 | *** join/#debian NoobCoder (unknowni@x1-6-e0-91-f5-90-af-9e.k62.webspeed.dk) |
| 14:30.15 | *** join/#debian kike (5819094a@gateway/web/freenode/ip.88.25.9.74) |
| 14:30.47 | *** join/#debian PhoenixSTF (~PhoenixST@87-196-247-36.net.novis.pt) |
| 14:31.00 | *** join/#debian llua (~llua@99-8-168-46.lightspeed.livnmi.sbcglobal.net) |
| 14:31.00 | *** join/#debian llua (~llua@unaffiliated/llua) |
| 14:32.23 | *** part/#debian kike (5819094a@gateway/web/freenode/ip.88.25.9.74) |
| 14:32.38 | Kobaz | i'm having problems running tripwire: tripwire: ../sysdeps/unix/sysv/linux/getpagesize.c:32: __getpagesize: Assertion `_rtld_global_ro._dl_pagesize != 0' failed. |
| 14:33.12 | Kobaz | i did some searches and some other people had this problem too, but there's no solution noted |
| 14:33.41 | *** join/#debian grandie (~thomas@p57ACEB23.dip.t-dialin.net) |
| 14:33.44 | Bar_ | Hi |
| 14:33.56 | Kobaz | i guess i'll try and build from source |
| 14:34.05 | *** join/#debian asias (~asias@apicoo.com) |
| 14:34.13 | Bar_ | Using async as an export option for an NFS mount - I'm storing user created images... if the server crashes - how many files can I lose ? |
| 14:34.42 | *** join/#debian andatche (~herb@beans.andatche.com) |
| 14:34.58 | *** join/#debian DimmuR (~DimmuR@77-87-137-42.internetia.net.pl) |
| 14:34.58 | *** join/#debian DimmuR (~DimmuR@unaffiliated/dimmur) |
| 14:35.22 | Kobaz | Bar_: depends how many files you're writing and how quickly |
| 14:35.42 | *** join/#debian mastroDani (~Daniele@85-18-52-10.ip.fastwebnet.it) |
| 14:36.06 | Bar_ | Kobaz: peak is at 15-20 per second |
| 14:36.13 | Kobaz | bar_: if you're writing one file and it hasn't been fully written, and the link dies, then you'll lose one file, if you wrote 1000 files and they haven't finished, you'll lose 1000 files |
| 14:36.33 | *** join/#debian Gilde (~Gilde@dslb-092-076-130-254.pools.arcor-ip.net) |
| 14:36.42 | Bar_ | But how much async waits ? |
| 14:36.51 | Bar_ | if it waits 30 sec between each write, it's bad |
| 14:36.58 | Bar_ | if it waits 0.3 sec, then it's fine by me |
| 14:36.59 | Bar_ | etc... |
| 14:37.01 | *** join/#debian kaltorak (~torak@186.16.42.9) |
| 14:37.12 | Kobaz | it's not a matter of waiting |
| 14:37.16 | *** join/#debian dtcrshr (guerrilhag@unaffiliated/datacrusher) |
| 14:37.25 | Kobaz | the server doesn't "wait". it's always doing something |
| 14:37.27 | Bar_ | async just tells the client "I'm done writing" before it did |
| 14:37.39 | Bar_ | When the server writes then ? |
| 14:37.51 | Kobaz | from the nfs website: |
| 14:37.53 | Kobaz | When set to "async," the Linux server replies to NFS clients before flushing data or metadata modifying operations to permanent storage, thus improving performance, but breaking all guarantees about server reboot recovery. |
| 14:38.09 | Bar_ | Yes, I read the man |
| 14:38.20 | Bar_ | It doesn't say when it flushes |
| 14:38.22 | Kobaz | so, you should have your answer |
| 14:38.28 | Kobaz | it flushes when it's done writing |
| 14:38.42 | Bar_ | That's not what the man says |
| 14:39.05 | *** join/#debian trumpets9000 (~sgoodpast@72.49.236.38) |
| 14:39.11 | Kobaz | with async, the server will say it's done so the client can continue it's request |
| 14:39.22 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 14:39.27 | Kobaz | meanwhile the nfs server will keep writing to disk until the file is done and will flush after |
| 14:39.46 | Bar_ | after = ? |
| 14:40.06 | Kobaz | read the source |
| 14:40.12 | Kobaz | i don't know the specifics |
| 14:40.20 | Kobaz | or maybe ask in #nfs or #kernel |
| 14:40.25 | Bar_ | thank you. |
| 14:40.30 | *** join/#debian webad_13_ (~milos@193.205.17.135) |
| 14:40.30 | Kobaz | it's not really a debian specific question |
| 14:40.33 | *** part/#debian jerojasro (~jerojasro@devnull.li) |
| 14:42.16 | beli | Kobaz: for your tripwire problem i guess that tripwire package hasnt been rebuild after latest glibc changes...and there are static deps |
| 14:42.19 | Kobaz | the bottom line is, if you're concerned about data, don't use async |
| 14:42.46 | Kobaz | if you want speed, use async... you can't have both speed and data integrity |
| 14:43.02 | *** join/#debian debsan (~debsan@190.245.74.16) |
| 14:43.18 | Kobaz | beli: i downloaded the tripwire source from apt-src but there's compile errors. i wonder if the official release is working |
| 14:43.26 | *** join/#debian bn` (~Patrick@178-26-185-176-dynip.superkabel.de) |
| 14:43.32 | *** join/#debian bn` (~Patrick@unaffiliated/bn/x-6686386) |
| 14:43.45 | beli | Kobaz: can you nopaste erros and your configure line used? |
| 14:43.56 | Kobaz | ./configure --prefix=/apps/tripwire |
| 14:44.00 | *** join/#debian AimHere (~bod@host81-152-113-96.range81-152.btcentralplus.com) |
| 14:44.34 | *** part/#debian kaltorak (~torak@186.16.42.9) |
| 14:44.39 | Kobaz | the build error i'm getting is for an uninitialized const.. i guess this was written for an older g++ |
| 14:45.38 | wols_ | Kobaz: are you using tripwire from debian? |
| 14:45.48 | wols_ | if so, you should check the bug database |
| 14:46.07 | *** join/#debian myosound (~myosound@smtp1.nationaltrust.org) |
| 14:46.31 | Kobaz | tripwire from debian doesn't build |
| 14:46.31 | *** join/#debian myosound (~myosound@smtp1.nationaltrust.org) |
| 14:47.00 | Kobaz | building the offical tripwire now |
| 14:47.03 | *** join/#debian p0g0 (~pogo@69.176.56.114.MRTC.static.mrtc.com) |
| 14:47.04 | *** join/#debian p0g0 (~pogo@unaffiliated/p0g0) |
| 14:47.46 | wols_ | that's definitely worth a bug report. you sure you aren't having an install where you use non debian packages, e.g. for compiler or such? |
| 14:47.53 | Kobaz | okay so the same problem is in the official source too |
| 14:47.58 | *** join/#debian EduardeCalibal (~Eduarde@novoseusadosinformatica.com.br) |
| 14:48.10 | Kobaz | wols_: all that stuff is debian packages |
| 14:48.34 | Kobaz | fcospec.cpp:75:31: error: uninitialized const 'defaultSpecMask' [-fpermissive] |
| 14:48.39 | wols_ | apt-get source -b MUST work. otherwise it's very very broken (at least if it's stable you run) |
| 14:48.49 | Kobaz | wols_: yeah, it doesn't |
| 14:49.05 | Kobaz | i'll try and see what defaultSpecMask should be initalized to |
| 14:49.41 | beli | Kobaz: ugly.....away from the bug: do you really need tripwire? what about aide or samhain? |
| 14:49.42 | *** join/#debian zippy (~zuppy@xdsl-92-252-86-199.dip.osnanet.de) |
| 14:50.14 | Kobaz | something that can crc check files and check for changes |
| 14:50.21 | *** join/#debian StuckDK (freenode@x1-6-e0-91-f5-90-af-9e.k62.webspeed.dk) |
| 14:50.22 | *** join/#debian kaiyin (~kaiyin@202.112.188.122) |
| 14:50.27 | *** join/#debian cahoot (~radix@c83-252-75-32.bredband.comhem.se) |
| 14:50.27 | *** join/#debian cahoot (~radix@pdpc/supporter/active/cahoot) |
| 14:50.40 | beli | Kobaz: aide |
| 14:50.54 | Kobaz | sounds good... trying to see if my silent disk corruption problems went away |
| 14:51.12 | themill | for that, I'd be tempted to use debsums |
| 14:51.20 | Kobaz | that sounds good too |
| 14:51.59 | *** join/#debian Parsifal (~steven@CPE-121-217-146-59.lnse2.cht.bigpond.net.au) |
| 14:52.13 | Kobaz | usually my libgtk*so's get corrupted and then firefox and thunderbird start crashing |
| 14:52.33 | *** join/#debian mostikx (~mast@88-149-208-120.dynamic.ngi.it) |
| 14:53.02 | *** join/#debian rooisto47 (c1c25e06@gateway/web/freenode/ip.193.194.94.6) |
| 14:53.06 | *** join/#debian binbrain (~binbrain@office.quietcaresystems.com) |
| 14:53.46 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:53.57 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:54.11 | *** join/#debian carlos_guerrilha (guerrilhag@200.145.119.137) |
| 14:54.16 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:54.32 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:54.39 | *** join/#debian NiLon (nilon@62-113-191-177.bb.dnainternet.fi) |
| 14:54.39 | *** join/#debian NiLon (nilon@unaffiliated/nilon) |
| 14:54.42 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:54.46 | mostikx | hi, what does it mean when lspci doesn't show an attached device? |
| 14:54.57 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:55.07 | dvs | it's a USB device? |
| 14:55.07 | Kobaz | mostikx: the device is most likly non-functioning |
| 14:55.15 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:55.18 | Kobaz | if it's a pci device anyway |
| 14:55.27 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:55.35 | *** part/#debian ppradhan (~Adium@nagarkot.ddns.uark.edu) |
| 14:55.40 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 14:55.40 | *** mode/#debian [+b *!*@99.32.63.28] by debhelper |
| 14:55.42 | *** kick/#debian [tensorpudding!~debhelper@unaffiliated/debhelper] by debhelper (Banned: join flood) |
| 14:55.42 | wols_ | that the PCI enumerator didn't find it when the system was booted |
| 14:56.07 | abrotman | hehe |
| 14:56.08 | mostikx | ok, so no drivers are envolved until that...ok? |
| 14:56.12 | abrotman | waves at wols_ |
| 14:56.29 | Kobaz | yeah, you don't need a functioning driver to see it in lspci |
| 14:56.34 | *** join/#debian buntfalke (~nobody@unaffiliated/buntfalke) |
| 14:56.42 | *** join/#debian hele (~hele@cs181225139.pp.htv.fi) |
| 14:56.47 | mostikx | thanks |
| 14:56.48 | wols_ | abrotman: you are another bentobox user, right? do you have problems with powertop as well? e.g. it doesn't show p-states |
| 14:56.50 | Kobaz | although you need a recent enough kernel to know what sort of item it is (unknown things will show up as unknown, but still be listed in the bus) |
| 14:56.55 | wols_ | hi, btw :P |
| 14:57.06 | Kobaz | what sort of card is it? |
| 14:57.08 | abrotman | bentobox? |
| 14:57.31 | wols_ | abrotman: black, rectangular, made in china. has some red nipple on the keyboard |
| 14:57.41 | mostikx | efficient networks 3060, a pci adsl modem |
| 14:57.46 | Nu^253r | I hate Dlink, its Wifi wont work on my box :( |
| 14:57.46 | abrotman | thinkpad? my powertop works fine last i knew |
| 14:57.55 | Kobaz | mostikx: does it work in another machine? |
| 14:58.13 | wols_ | abrotman: mine uses 300W when idle (and 26W longterm...), shows no p-states, etc |
| 14:58.24 | abrotman | i'm also not sitting in front of it |
| 14:58.24 | mostikx | i don't know .. i've not other machine.. |
| 14:58.29 | wols_ | mostikx: and this modem is a internal PCI card? |
| 14:58.34 | mostikx | ye |
| 14:58.36 | mostikx | yes |
| 14:59.19 | Kobaz | mostikx: try moving to a different slot? |
| 14:59.46 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 15:00.01 | *** join/#debian ksinkar (~ksinkar@122.169.38.135) |
| 15:00.04 | mostikx | i'll try |
| 15:00.11 | ksinkar | hello people |
| 15:00.15 | ksinkar | i am new to debian |
| 15:00.22 | wols_ | ksinkar: welcome |
| 15:00.31 | ksinkar | i want to install debian, but not the stable version |
| 15:00.51 | ksinkar | i have a friend who is a debian user |
| 15:01.04 | ksinkar | he told me to download the testing debian images |
| 15:01.13 | wols_ | what's wrong with debian stable? |
| 15:01.28 | ksinkar | wols_: it has a lot of things which are outdated |
| 15:01.38 | ksinkar | wols_: it is supposed to be only for servers |
| 15:01.41 | ksinkar | not the cutting edge |
| 15:01.44 | stew | its not only for servers |
| 15:01.49 | ksinkar | i am used to fedora |
| 15:02.03 | stew | ksinkar: are the outdated things available from backports.debian.org? |
| 15:02.06 | Kobaz | stable is for people who want stuff that generally works |
| 15:02.23 | ksinkar | stew: i really don't know |
| 15:02.31 | ksinkar | i am just repeating what i was told |
| 15:02.42 | BlackFate | ksheurs, you can try the weekly builds. http://cdimage.debian.org/cdimage/weekly-builds/ |
| 15:02.45 | Kobaz | although i run unstable myself and the worst that I run into is generally dependency problems |
| 15:02.47 | ksinkar | and now i am looking for a mirror where i can download the iso image |
| 15:03.51 | *** join/#debian mastroWork (~Daniele@85-18-52-10.ip.fastwebnet.it) |
| 15:05.31 | *** join/#debian aldin_ (~aldin@188.127.108.50) |
| 15:05.34 | babilen | ksinkar: Please install the stable release of Debian and come here whenever you need help with something. There are different ways to install newer versions of software than those that are available in stable and you will run into serious problems when you run testing or unstable. |
| 15:05.36 | ksinkar | BlackFate: thanx |
| 15:05.51 | babilen | !tell ksinkar about overview |
| 15:06.03 | Kobaz | babilen: what serious problms are there in testing/unstable? |
| 15:06.20 | *** join/#debian w00tw00tw00t (~w00t@cm13.zeta96.maxonline.com.sg) |
| 15:06.20 | ksinkar | babilen: i want to learn and hack thats why i am installing debian |
| 15:06.25 | w00tw00tw00t | any ideas how to add files to an ISO image? |
| 15:06.40 | *** join/#debian afiestas (~afiestas@conference/ubuntudevelopersummit/x-ryajsiphanojwuao) |
| 15:06.41 | stew | Kobaz: how about the /run problem recently? |
| 15:06.44 | Kobaz | w00tw00tw00t: rebuild the iso |
| 15:06.52 | babilen | Kobaz: Where to start? There is the udev,/run and initscript transitions, the perl transition and a bunch of other things that make testing/unstable a very bumpy ride these days. |
| 15:06.53 | beli | ksinkar: but why unstable if there is no need for the newest stuff? |
| 15:06.53 | Kobaz | stew: hmm, heh... which problem is that? |
| 15:07.11 | w00tw00tw00t | it is a bootable iso |
| 15:07.30 | Kobaz | w00tw00tw00t: iso9660 has no capability for adding files |
| 15:07.38 | w00tw00tw00t | shucks... ok |
| 15:07.47 | stew | Kobaz: that /run was created before everyone was ready for it? |
| 15:07.48 | babilen | w00tw00tw00t: http://wiki.debian.org/DebianCustomCD |
| 15:07.59 | *** join/#debian robertdavid (~Robert@gate.chabry.cz) |
| 15:08.02 | *** join/#debian aidaho (~aidaho@228-151-134-95.pool.ukrtel.net) |
| 15:08.03 | w00tw00tw00t | babilen, thanks |
| 15:08.07 | babilen | w00tw00tw00t: Ah, you meant in general? No, you can't do that. :) |
| 15:08.15 | Kobaz | stew: oh, i haven't installed unstable in a while, i just have an image i deploy and then use apt-get accordingly |
| 15:08.23 | stew | Kobaz: the udev problem |
| 15:08.31 | Kobaz | a udev problem sounds bad |
| 15:08.52 | Kobaz | perl i've been okay with, it does break some things like pidgin though |
| 15:09.39 | BlackFate | Kobaz, babilen if things break then dont upgrade. knowing when to upgrade is sid and when to wait is the alpha and the omega |
| 15:09.39 | Kobaz | i guess it depends upon your specific use case whether you get affected by nasty bugs or not |
| 15:09.43 | *** join/#debian bint (bint@cable-static-220-208.intergga.ch) |
| 15:09.56 | BlackFate | s/is/in |
| 15:10.04 | babilen | BlackFate: I am well aware of that |
| 15:10.25 | Kobaz | speaking of when to upgrade, looks like pidgin dependencies are fixed now |
| 15:10.54 | stew | Kobaz: aiui, this was causing anyone fully up to date on unstable to not be able to have udev load modules |
| 15:11.00 | *** mode/#debian [+l 1120] by debhelper |
| 15:11.01 | Kobaz | BlackFate: i have my lab/dev machines to break and when everything is all fine and good, the stuff goes into production |
| 15:11.20 | Kobaz | stew: ah, that sounds bad |
| 15:11.36 | Kobaz | i don't use modules though |
| 15:11.43 | w00tw00tw00t | it seems that in OS X, one could add files to an ISO: http://www.insanelymac.com/forum/lofiversion/index.php/t46304.html |
| 15:11.52 | *** join/#debian rolandpish (~rolandpis@201.194.34.10) |
| 15:12.12 | *** join/#debian ymasory (~ymasory@c-76-99-55-224.hsd1.pa.comcast.net) |
| 15:12.24 | *** join/#debian NiLoni (nilon@unaffiliated/nilon) |
| 15:12.25 | Kobaz | w00tw00tw00t: it must be doing a complete rebuild when adding the files |
| 15:12.26 | stew | Kobaz: of course testing usually has known security problems. when we are doing large transitions, we have to break large metapackages like "gnome" or "kde" frequently in testing |
| 15:12.36 | Kobaz | stew: ah |
| 15:13.08 | *** join/#debian mtn (~mtn@99-196-115-14.cust.wildblue.net) |
| 15:13.55 | babilen | FWIW, check the /topic of #debian-next on irc.debian.org / irc.oftc.net for links to the list of ongoing transitions and a sid faq |
| 15:14.30 | *** join/#debian AdvoWork (~AdvoWork@unaffiliated/advowork) |
| 15:14.46 | AdvoWork | hi there, if ive just edited /etc/static-dns-hosts do i need to restart anything or? |
| 15:15.00 | Kobaz | w00tw00tw00t: either that or it's adding onto it with multi session |
| 15:15.11 | Touns | Hello :) |
| 15:15.14 | Kobaz | w00tw00tw00t: (from the pedia) ISO 9660 is by design a read-only, pre-mastered file system. This means that all the data has to be written in one go to the medium. Once written, there is no provision for altering the stored content. Therefore ISO 9660 is not suitable to be used on random-writable media, such as hard disks. |
| 15:15.20 | mostikx | Kobaz: i plugged the pci modem into an other slot but during the boot a message "BUG: soft lockup - CPU#0 stuck for 61s" appears .. |
| 15:15.29 | w00tw00tw00t | Kobaz,ok |
| 15:15.37 | Kobaz | mostikx: does the kernel continue booting? |
| 15:15.49 | Touns | please, someone know why dh_make create me an almost empty rules file ? |
| 15:15.59 | justin_ | AdvoWork: what is /etc/static-dns-hosts ? |
| 15:16.02 | mostikx | no |
| 15:16.08 | Kobaz | mostikx: sounds like a bad card |
| 15:16.13 | Touns | I didn't have the same skeletton as usual in lenny (I'm on squeeze now) |
| 15:16.18 | *** join/#debian hell_razer (~HellRaise@196-175-179-94.pool.ukrtel.net) |
| 15:16.25 | w00tw00tw00t | somebody should amend the wiki page that states how to write to ISO: https://help.ubuntu.com/community/MountIso |
| 15:16.29 | mostikx | :-( |
| 15:17.11 | Kobaz | w00tw00tw00t: that page is for reading isos |
| 15:17.30 | w00tw00tw00t | "To mount the image so that it can be written to, use the following mount command instead: " |
| 15:17.40 | w00tw00tw00t | sudo mount -o rw,loop example.iso /media/example |
| 15:17.59 | *** join/#debian thinksteve (~stephan@p579BD365.dip.t-dialin.net) |
| 15:18.03 | *** join/#debian buntfalke_ (~nobody@unaffiliated/buntfalke) |
| 15:18.53 | *** join/#debian trumpets9000 (~sgoodpast@72.49.236.38) |
| 15:19.01 | Kobaz | w00tw00tw00t: the page is wrong, you won't be able to write it |
| 15:19.16 | *** join/#debian cahoot (~radix@pdpc/supporter/active/cahoot) |
| 15:19.21 | w00tw00tw00t | thats why i said somebody should amend the page... :) |
| 15:19.34 | Kobaz | oh, right... i see what you're saying |
| 15:19.56 | *** join/#debian AbsintheSyringe (~havoc@91.82.208.3) |
| 15:19.58 | Kobaz | i thought you were saying it should talk about how to write an iso, but the page is clearly about mounting and reading |
| 15:20.20 | w00tw00tw00t | oh well, thanks anyway, gtg |
| 15:20.21 | Kobaz | but yeah, that should be fixed... you *can* mount it rw, but the kernel will complain loudly when you try and write a file |
| 15:20.44 | *** join/#debian pyrony (~epic@173.151.228.97) |
| 15:20.50 | Kobaz | but this is #debian and not #ubuntu, so you can bug those guys about it |
| 15:21.45 | *** join/#debian buntfalke_ (~nobody@unaffiliated/buntfalke) |
| 15:21.58 | *** join/#debian crypted (~doobie@ip72-198-16-171.ok.ok.cox.net) |
| 15:22.07 | Kobaz | there are tools to mount an iso and add to it, but they will rebuild the iso for you... and you'll have to take care to use a tool that maintains the bootability |
| 15:22.34 | Kobaz | red warrior now has -- temporary bootability |
| 15:22.51 | *** join/#debian TinBird (~kfm@cpe-24-90-180-155.nyc.res.rr.com) |
| 15:23.15 | *** join/#debian Ox1 (~admin@s537575db.adsl.wanadoo.nl) |
| 15:24.02 | *** join/#debian buntfalke_ (~nobody@unaffiliated/buntfalke) |
| 15:25.11 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 15:25.25 | *** join/#debian buntfalke (~nobody@unaffiliated/buntfalke) |
| 15:26.01 | *** mode/#debian [-b *!*@99.32.63.28] by debhelper |
| 15:28.16 | *** join/#debian b52 (~b52@unaffiliated/b52) |
| 15:28.30 | b52 | hey, which package covers virt-resize and all other useful virt tools ? |
| 15:29.05 | *** join/#debian vazel (~wizl@93-103-188-190.dynamic.t-2.net) |
| 15:29.42 | *** join/#debian buntfalke (~nobody@unaffiliated/buntfalke) |
| 15:30.35 | abrotman | !tell b52 about apt-file |
| 15:31.00 | *** join/#debian rafuch0 (~flux@190.38.228.128) |
| 15:31.06 | *** join/#debian Myztik (~Myztik@80-164.anonymous.at.anonine.com) |
| 15:33.04 | wols_ | or package.debian.org which is faster than installing apt-file :) |
| 15:35.03 | *** join/#debian buntfalke (~nobody@unaffiliated/buntfalke) |
| 15:35.27 | *** part/#debian ellisgeek (~ellisgeel@66-190-33-174.dhcp.fdul.wi.charter.com) |
| 15:37.48 | *** join/#debian buntfalke_ (~nobody@unaffiliated/buntfalke) |
| 15:38.23 | *** join/#debian ellisgeek (~ellisgeel@66-190-33-174.dhcp.fdul.wi.charter.com) |
| 15:38.37 | *** join/#debian tempeldirne (~L@gssn-5f7575c0.pool.mediaWays.net) |
| 15:38.54 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 15:39.12 | *** join/#debian Zylvain (~Zylvain@2a01:e35:8a07:4aa0:215:afff:fea2:cf66) |
| 15:39.26 | *** join/#debian pLk (~mail@xdsl-188-118-178-90.dip.osnanet.de) |
| 15:40.24 | *** join/#debian ElDiabolo_ (~jo@46.115.18.48) |
| 15:40.46 | *** join/#debian jahil1 (~mohsin@94.203.101.202) |
| 15:41.15 | *** part/#debian AdvoWork (~AdvoWork@unaffiliated/advowork) |
| 15:42.11 | *** join/#debian mu3en (~quassel@adsl-62-167-99-85.adslplus.ch) |
| 15:45.47 | *** join/#debian Phil-Work` (~phil@87.84.128.98) |
| 15:49.06 | *** join/#debian _dreamy (~quassel@bl5-188-243.dsl.telepac.pt) |
| 15:49.45 | *** join/#debian Cyanure (~Cyanure@212-198-160-108.rev.numericable.fr) |
| 15:50.52 | *** join/#debian doleyb (~pwickis@pool-173-76-249-18.bstnma.fios.verizon.net) |
| 15:51.34 | *** join/#debian wissem (~wissem@unaffiliated/wissem) |
| 15:53.57 | *** join/#debian smica (~smica@109-61-48-99.adsl-pool.dravanet.hu) |
| 15:55.12 | *** join/#debian dajhorn (~dajhorn@adsl-75-17-126-238.dsl.rcsntx.sbcglobal.net) |
| 15:56.29 | *** join/#debian ssfdre38 (~ssfdre38@unaffiliated/ssfdre38) |
| 15:57.06 | *** join/#debian Jussi_ (~jussi@0132700296.0.fullrate.dk) |
| 15:57.45 | *** join/#debian Anubisss (~anubisss@77.111.167.209) |
| 15:57.49 | *** join/#debian ssfdre38 (~ssfdre38@unaffiliated/ssfdre38) |
| 15:59.24 | *** join/#debian Spec (~nwheeler@charon.devis.com) |
| 15:59.30 | *** join/#debian Spec (~nwheeler@unaffiliated/spec) |
| 16:00.24 | *** join/#debian naiv (~naiv@ARennes-553-1-161-220.w86-214.abo.wanadoo.fr) |
| 16:00.47 | *** join/#debian linuxfreck (~chris@2001:4dd0:fdc3:0:299a:1ba4:3a07:fa94) |
| 16:01.03 | *** join/#debian Kazen (~Kazen@541F86A1.cm-5-8c.dynamic.ziggo.nl) |
| 16:01.13 | *** join/#debian edog (~edog@86.57.150.104) |
| 16:02.24 | *** join/#debian jhutchins_lt (~jonathan@64-151-37-66.dyn.everestkc.net) |
| 16:02.24 | *** join/#debian gnusosa_ (~gnusosa@67.123.125.8) |
| 16:02.26 | *** join/#debian philrene (~PhilRene@76.70.26.120) |
| 16:02.39 | *** join/#debian smica_ (~smica@109-61-48-99.adsl-pool.dravanet.hu) |
| 16:03.22 | *** join/#debian Roma_39m (~mirc@93.40.69.84) |
| 16:03.46 | naiv | troll off, what does /etc stands for ? |
| 16:04.13 | *** join/#debian m4ggus (~m4ggus@p5DD53F13.dip.t-dialin.net) |
| 16:04.31 | *** join/#debian cdahmede- (~cdahmedeh@174.115.212.138) |
| 16:05.24 | *** join/#debian homie (~levgue@xdsl-78-35-133-92.netcologne.de) |
| 16:07.09 | nkuttler | !tell naiv about fhs |
| 16:07.58 | *** part/#debian jujugre (~julienb@artis3.probesys.com) |
| 16:09.52 | *** join/#debian sh_sh (~sh_sh@g229053004.adsl.alicedsl.de) |
| 16:10.04 | jhutchins_lt | naiv: http://en.wikipedia.org/wiki/Et_cetera |
| 16:10.35 | *** join/#debian C-boys (~coreboy@212.117.181.34) |
| 16:10.37 | C-boys | What is considered a good dedicated server provider in the netherlands? Worldstream? Leaseweb? |
| 16:10.42 | *** join/#debian omeddragon (~omeddrago@pool-71-178-234-18.washdc.fios.verizon.net) |
| 16:11.00 | *** mode/#debian [+l 1126] by debhelper |
| 16:11.08 | *** join/#debian Roma_39m (~mirc@93-40-69-84.ip37.fastwebnet.it) |
| 16:12.11 | naiv | btw, before asking I read that "et cetera" and "Editable Text Config" were 2 theories. |
| 16:13.35 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 16:15.05 | *** join/#debian DammitJim (~Elive_use@99-75-56-77.lightspeed.dybhfl.sbcglobal.net) |
| 16:17.04 | *** join/#debian gnufreex (~quassel@91-150-125-49.dynamic.isp.telekom.rs) |
| 16:17.15 | *** join/#debian bman (~bman@sat-69-171-166-56.evdo.leapwireless.net) |
| 16:20.35 | *** join/#debian wissem (~wissem@unaffiliated/wissem) |
| 16:21.31 | *** join/#debian smica__ (~smica@109-61-48-99.adsl-pool.dravanet.hu) |
| 16:21.33 | *** join/#debian Endres (~ep@p5B32649F.dip.t-dialin.net) |
| 16:21.43 | *** join/#debian gjs (~gjs@GSWoT/Member/gjs) |
| 16:24.29 | *** join/#debian zgedneil (~rus@cpc1-cbly2-0-0-cust455.6-2.cable.virginmedia.com) |
| 16:24.44 | *** join/#debian [SkG] (~SkG@unaffiliated/skg/x-897332) |
| 16:25.06 | *** join/#debian alex__ (~alex@ks34596.kimsufi.com) |
| 16:25.12 | alexidoia | hi there |
| 16:25.13 | *** join/#debian woung (~woung@41.204.87.33) |
| 16:26.06 | *** join/#debian Spec (~nwheeler@unaffiliated/spec) |
| 16:26.10 | jhutchins_ltna | naiv: It's one of those things that nobody really remembers what the origin was, so they make things up that make sense. |
| 16:26.24 | *** join/#debian zippy (~zuppy@xdsl-92-252-86-199.dip.osnanet.de) |
| 16:26.25 | alexidoia | I have a problem. One of my apache site is offering a back door, it is nothing too serious but I'd like to find a way to know which site exactly is weak. How can I do this ? |
| 16:27.12 | *** join/#debian Innocentus (~Innocentu@p57A23086.dip.t-dialin.net) |
| 16:27.16 | alexidoia | say I have the PID of the ps |
| 16:27.39 | *** join/#debian omeddragon (~omeddrago@pool-71-178-234-18.washdc.fios.verizon.net) |
| 16:28.11 | *** join/#debian Tuxist (~quassel@dyndsl-031-150-009-070.ewe-ip-backbone.de) |
| 16:31.54 | *** join/#debian MrOpposite (~mropposit@unaffiliated/mropposite) |
| 16:33.55 | *** join/#debian xyzp (~chatzilla@c-295ae155.12-1-64736c11.cust.bredbandsbolaget.se) |
| 16:34.22 | *** join/#debian muenchhausen (~hollunder@eris.mozart.uni-klu.ac.at) |
| 16:34.30 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 16:34.43 | *** join/#debian exekias (~quassel@ks36124.kimsufi.com) |
| 16:34.58 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 16:35.53 | *** join/#debian sh_sh_ (~sh_sh@e179129080.adsl.alicedsl.de) |
| 16:35.57 | *** join/#debian LegolasV (~whoeiii35@kde/developer/sverberkt) |
| 16:36.37 | xyzp | How do i update Vlc in the consol? |
| 16:38.01 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 16:38.34 | nkuttler | xyzp: what do you normally use to install packages? |
| 16:38.34 | *** part/#debian skrewler (~skrewler@70-36-139-26.dsl.dynamic.sonic.net) |
| 16:38.37 | *** join/#debian dvs (~me@cwv.teksavvy.com) |
| 16:39.12 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 16:39.33 | *** join/#debian pyrony (~epic@office1.klout.com) |
| 16:39.51 | xyzp | nkuttler, i am new with linux, so i have nevever done that earlier |
| 16:40.02 | *** join/#debian aguitel (~aguitel@190.194.135.216) |
| 16:40.16 | *** join/#debian BladeFreak (~BladeFrea@unaffiliated/bladefreak) |
| 16:40.16 | nkuttler | xyzp: did you install debian by yourself? |
| 16:40.38 | xyzp | nkuttler, no |
| 16:41.00 | *** mode/#debian [+l 1133] by debhelper |
| 16:41.11 | nkuttler | xyzp: you should probably ask the person who installed it for you |
| 16:41.22 | nkuttler | i think apt-get is recommended these days, but i'm not sure |
| 16:41.30 | *** join/#debian arj1singh (~arjun@49.203.100.143) |
| 16:41.32 | *** join/#debian thiagoss (~thiagoss@189.81.45.107) |
| 16:42.01 | *** join/#debian zepp^ (~zepp@j194139.upc-j.chello.nl) |
| 16:42.21 | *** join/#debian kenjy (~kenjy@189.146.193.209) |
| 16:42.58 | *** join/#debian osfd (~olivier@rke75-8-78-225-170-15.fbx.proxad.net) |
| 16:44.09 | xyzp | nkuttler, ok |
| 16:44.21 | arj1singh | hid3, can anyone please help me for restoring from hibernation in Debian 6.0. I can choose hibernation from GNOME and it shows that saving the state and power off but when switching it on again it starts normal. :( |
| 16:44.32 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 16:45.01 | arj1singh | *Hi, |
| 16:45.23 | nkuttler | xyzp: notice though that you don't really update individual packages, unless there is a new debian release |
| 16:45.47 | nkuttler | xyzp: why do you need a newer vlc anyway? |
| 16:47.00 | jhutchins_lt | arj1singh: That's really a hardware ACPI issue. My Acer One is unreliable about it, sometimes it reloads, sometimes it reboots. Not really much that can be done about it. |
| 16:47.05 | jhutchins_lt | arj1singh: Which kernel are you running? |
| 16:47.30 | *** join/#debian tblamer (~tblamer@32.97.110.58) |
| 16:47.43 | arj1singh | 2.6.32-5-amd64 |
| 16:48.00 | jhutchins_lt | nkuttler: apt-get is recommended for the lenny->squeeze upgrade due to a possible dependency loop in aptitude; generally aptitude does better dependency resolution. |
| 16:48.15 | jhutchins_lt | arj1singh: You might try the .38 kernel from backports. |
| 16:48.18 | *** join/#debian pyro__ (~pyro___@unaffiliated/pyro-/x-1498221) |
| 16:48.54 | jhutchins_lt | arj1singh: That has all the logic of flipping the switch on and off a few times, but it might have later drivers. |
| 16:50.48 | *** join/#debian apelgate (~apel@s83-191-241-173.cust.tele2.se) |
| 16:51.03 | jelly | magic or more magic |
| 16:51.16 | muenchhausen | Hi there. After finishing the grub update debian can't find the disk anymore, it waits for root and drops to busybox. Is this a known issue? |
| 16:51.43 | arj1singh | jhutchins_lt, it seems to be fine. I think some problem is there in restoring script, but I might be wrong. |
| 16:51.50 | nkuttler | jhutchins_lt: i see |
| 16:51.51 | *** mode/#debian [+o themill] by ChanServ |
| 16:51.58 | *** join/#debian lcafiero (~larry@dsl-74-220-75-41.dhcp.cruzio.com) |
| 16:52.04 | *** topic/#debian by themill -> squeeze (6.0.1) released; /msg dpkg squeeze ; /msg dpkg lenny->squeeze | lenny (5.0.8) /msg dpkg 5.0.8 | NO FLOOD: /msg dpkg pastebin | /msg bots NOT people | offtopic: #debian-offtopic | wheezy/sid: #debian-next (irc.oftc.net) | FAQ: http://deb.li/IRCFAQ | channel logs: http://deb.li/yQXC |
| 16:52.10 | themill | topicdiff: md5sums fixed now; website no longer "new"; #debian-next |
| 16:52.15 | *** mode/#debian [-o themill] by themill |
| 16:52.27 | xyzp | aptitude 0.4.4 |
| 16:53.13 | *** join/#debian lord_rob (robert@66.223-247-81.adsl-dyn.isp.belgacom.be) |
| 16:53.13 | *** join/#debian lord_rob (robert@unaffiliated/lord-rob/x-573835) |
| 16:53.43 | jhutchins_lt | ,versions aptitude |
| 16:53.46 | judd | Package aptitude on i386 -- lenny: 0.4.11.11-1~lenny1; squeeze: 0.6.3-3.2; sid: 0.6.3-4; wheezy: 0.6.3-4 |
| 16:54.01 | *** join/#debian trbs (~trbs@2001:470:d2ad:1:4a5b:39ff:fe7d:1623) |
| 16:54.01 | *** join/#debian ymasory (~ymasory@frank.ldc.upenn.edu) |
| 16:54.03 | *** join/#debian scarface (~brute@host46-19-dynamic.11-87-r.retail.telecomitalia.it) |
| 16:54.11 | *** join/#debian {41444d494e} (~kvirc@178.123.230.30) |
| 16:54.21 | jhutchins_lt | xyzp: Who is your provider? That seems like a pretty old version of aptitude. |
| 16:54.32 | *** part/#debian Guest78013 (~brute@host46-19-dynamic.11-87-r.retail.telecomitalia.it) |
| 16:55.08 | *** join/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 16:55.55 | *** join/#debian tensorpudding (~tensorpud@99.32.63.28) |
| 16:57.12 | Endres | My lenny Homeserver is not starting up everytime. The problem seems to be my Software RAID 5 on which my "/"-Partition is. http://pastebin.com/9TYmPr37 Sometimes it even occurs while setting up the swap. Then nothing happens, it shows the characters I type on the keyboard but I can't do anything with it but restart. The reboot works then, but anyway this behaviour is not right. And the RAID must be checked for three hours after it. |
| 16:57.17 | gremset | What is the path and name of the file where we can set the boot parameter, tell it to use no gui, and change resolution of tty? |
| 16:57.19 | *** join/#debian TheWarden (~thewarden@S0106001cf0c3da95.ss.shawcable.net) |
| 16:57.33 | Endres | what can I do? Does upgrading to squeeze suffice? |
| 16:57.58 | *** join/#debian Spec (~nwheeler@unaffiliated/spec) |
| 16:58.08 | *** join/#debian XSoul (~XRule@tooms.ddns.cablebg.net) |
| 16:59.04 | *** join/#debian buhman_ (~zack@unaffiliated/zjblabs) |
| 17:04.16 | *** join/#debian cornair (~cornair@pd95c90a6.dip0.t-ipconnect.de) |
| 17:04.43 | *** join/#debian gusto___ (~gusto@p4FFE724C.dip.t-dialin.net) |
| 17:04.53 | jhutchins_lt | Endres: I think you can insert a delay that waits longer for the RAID to come on-line during startup. Only search terms I can think of are "raid + boot delay". |
| 17:06.01 | Endres | jhutchins_lt: Thanks, I could try this. But I can't say if this works because the problem only occurs maybe once in a week. |
| 17:06.33 | jhutchins_lt | Endres: How often do you reboot that server? |
| 17:07.24 | Endres | jhutchins_lt: Well, every day for ecological reasons :) |
| 17:07.47 | Endres | i.e. shutting down in the night and starting up in the morning |
| 17:08.16 | jhutchins_lt | Endres: That's rather hard on the hardware, but noble of you. |
| 17:08.30 | Endres | nah, it's no real server |
| 17:08.31 | *** join/#debian pierrep (~pierrep@65.94.47.151) |
| 17:08.35 | *** join/#debian WifiBrn2 (brain@cpc2-mapp3-0-0-cust318.12-4.cable.virginmedia.com) |
| 17:08.39 | Endres | its just my "home-server" |
| 17:08.52 | Endres | otherwise it would got hardware raid |
| 17:09.06 | *** join/#debian Savis (c624a55a@gateway/web/freenode/ip.198.36.165.90) |
| 17:09.40 | Savis | Lets see if this channel is more alive than the samba one LOL... I have a share that i need to create in samba that has some specific security needs I need Group A to have full access Group B to have read only access and Group C have full access except Delete. I do have ACL installed as well |
| 17:10.08 | *** join/#debian miguetan (~miguetan@237.242.165.83.dynamic.mundo-r.com) |
| 17:11.00 | *** mode/#debian [+l 1141] by debhelper |
| 17:11.02 | *** join/#debian Jemt (~Jemt@0x5550950d.adsl.cybercity.dk) |
| 17:11.06 | *** join/#debian tq (~tobias@cpc12-brig15-2-0-cust154.3-3.cable.virginmedia.com) |
| 17:13.02 | *** join/#debian nvz (~nvz@c-76-125-250-135.hsd1.wv.comcast.net) |
| 17:13.21 | *** join/#debian dtcrshr (guerrilhag@200.145.119.137) |
| 17:13.21 | *** join/#debian dtcrshr (guerrilhag@unaffiliated/datacrusher) |
| 17:13.27 | jhutchins_lt | Savis: So? |
| 17:15.20 | *** join/#debian iluminator101 (~iluminato@unaffiliated/iluminator101) |
| 17:15.29 | *** join/#debian ssfdre38 (~ssfdre38@unaffiliated/ssfdre38) |
| 17:15.42 | nvz | why does "schroot -c opensim OpenSim" tell me /usr/local/bin/OpenSim: exec format error? just doing schroot -c opensim then running OpenSim works.. |
| 17:16.15 | Endres | jhutchins_lt: so when should the delay take place? |
| 17:16.26 | *** join/#debian EduardeCalibal (~Eduarde@novoseusadosinformatica.com.br) |
| 17:16.43 | zgedneil | nvz: try escaping the space between opensim and OpenSim |
| 17:16.51 | *** join/#debian poncha|laptop (~poncha@unaffiliated/poncha) |
| 17:17.08 | zgedneil | e.g. with a backslash |
| 17:17.11 | jhutchins_lt | Endres: I am just going from a discussion I observed here, it is an option on the kernel command line typically added to grub. |
| 17:17.43 | jhutchins_lt | nvz: That would appear to be a difference in architecture between the OS and the program you're trying to run. |
| 17:17.52 | nvz | zgedneil: but there is suppose to be a space between chroot and command |
| 17:18.24 | zgedneil | I was speculating that schroot's -c might work like e.g. su's -c |
| 17:18.39 | jhutchins_lt | Endres: The delay allows additional time for the raid to become responsive, so I presume after the raid drivers are loaded from the initramfs, but before anything else is read from the physical disk. |
| 17:19.05 | zgedneil | nvz: schroot seems to be running OpenSim as a command, your command-line suggests that isn't what you intend |
| 17:19.12 | nvz | jhutchins its a bash script that changes the dir and executes mono. it works inside the chroot but not from schroot commandline |
| 17:19.59 | zgedneil | nvz: to rephrase my earlier suggestion, have you tried putting the command you want to run in quotes? |
| 17:20.19 | *** join/#debian brbrbr (~user@unaffiliated/brbrbr) |
| 17:20.21 | *** join/#debian Larstorbe (57976f67@gateway/web/freenode/ip.87.151.111.103) |
| 17:20.34 | *** join/#debian ajikeshi (~ajikeshi@unaffiliated/ajikeshi) |
| 17:21.00 | *** join/#debian cataliyst (~L@202.46.129.123) |
| 17:21.08 | stew | nvz: what does "which OpenSim" return after chrooting? |
| 17:21.31 | nvz | znedneil1: that doesnt help either suggestion |
| 17:21.49 | *** join/#debian bixgomez (~bixgomez@c-24-16-37-138.hsd1.wa.comcast.net) |
| 17:22.19 | zgedneil | awesome typing |
| 17:22.24 | stew | ? |
| 17:22.29 | zgedneil | I presume opensim is a directory then? |
| 17:22.31 | stew | zgedneil: you seem to be misunderstanding something |
| 17:22.39 | nvz | stew: /usr/local/bin/OpenSim |
| 17:22.43 | *** join/#debian iluminator101 (~iluminato@unaffiliated/iluminator101) |
| 17:22.47 | stew | zgedneil: its the name of the chroot |
| 17:22.58 | Savis | jhutchins_lt: so im wondering where i can find some decent documentation to help me set up a share with those specific needs.... |
| 17:23.08 | iluminator101 | E: Archive directory /var/cache/apt/archives/partial ???? |
| 17:23.11 | cataliyst | someone please help me, how to install debian on IBM 3620 m3.. :( |
| 17:23.42 | nvz | stew: the script is 777 and runs just by typing OpenSim in the chroot |
| 17:23.45 | stew | nvz: its a shell script? what is the shebang? |
| 17:23.51 | *** join/#debian toxical (~francisco@187.149.76.55) |
| 17:23.55 | iluminator101 | E:internal error: couldnt generate list of packages to download |
| 17:24.02 | jhutchins_lt | Savis: The best documentation would be at the samba web site. |
| 17:24.21 | stew | nvz: does it work if you specify a full path |
| 17:24.46 | Savis | does samba support what i am trying to do ? |
| 17:24.48 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 17:24.53 | stew | nvz: or if you specify the interpreter? like "schroot -c opensim /bin/bash /usr/local/bin/OpenSim" ? |
| 17:25.08 | stew | nvz: oh, wait, do you need a -- before the command name? |
| 17:25.09 | nvz | stew: ah.. it doesnt have one... |
| 17:25.10 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 17:25.22 | jhutchins_lt | cataliyst: No help from IBM? |
| 17:25.25 | wildc4rd | evening all |
| 17:25.28 | stew | ah, that might explain it |
| 17:25.35 | *** join/#debian Tigger__ (~Tigger__@cpc4-fare6-2-0-cust436.6-1.cable.virginmedia.com) |
| 17:25.49 | jhutchins_lt | Savis: Yes, security by group is part of the samba system. |
| 17:26.01 | *** join/#debian brandonw (~brandonw@68-112-236-86.dhcp.oxfr.ma.charter.com) |
| 17:26.05 | *** join/#debian francisco_ (~francisco@187.149.76.55) |
| 17:26.11 | DammitJim | man, my hard drive seems super slow lately... as if it's fragmented. I'm using jfs |
| 17:26.19 | DammitJim | anything I can do to make sure it's not fragmented? |
| 17:26.28 | *** join/#debian smica__ (~smica@109-61-48-99.adsl-pool.dravanet.hu) |
| 17:26.57 | cataliyst | jhutchins_lt: debian can't detect the hard drive, |
| 17:27.25 | nvz | stew: yeah just needed the shebang... im doing everything thru a cell phone atm.. heh |
| 17:27.31 | jhutchins_lt | cataliyst: Which release of debian are you trying? |
| 17:27.36 | cataliyst | jhutchins_lt: but it works when I set it to RAID 0 or RAID 1 |
| 17:27.59 | cataliyst | jhutchins_lt: debian squeeze amd64 |
| 17:28.21 | nvz | lack of a tab and ctrl key slows me down a lot |
| 17:28.35 | cataliyst | jhutchins_lt: the debian himself ask me for some driver that I couldn't understand |
| 17:28.42 | *** join/#debian francisco__ (~francisco@187.149.76.55) |
| 17:28.43 | *** join/#debian Deadguy (~Deadguy@pdpc/supporter/active/deadguy) |
| 17:29.26 | jhutchins_lt | cataliyst: Makes sense, you probably need some firmware for the disk controller. Work harder at understanding what it's asking you for. |
| 17:29.34 | jhutchins_lt | !firmware |
| 17:29.34 | dpkg | Firmware is software to operate electronic devices, usually contained in EPROM or flash memory. Some drivers require firmware to be provided from userspace, prior to device operation, notably for <WiFi> devices. Most firmware files are not part of a Debian release as they do not conform to the <DFSG>; some are available via <contrib> and <non-free> packages. See also <search>, <installer firmware>. http://wiki.debian.org/Firmware |
| 17:30.04 | *** join/#debian Ricardo__ (~rick@187.107.20.138) |
| 17:30.05 | *** join/#debian themill (~stuart@unaffiliated/themill) |
| 17:30.08 | jhutchins_lt | cataliyst: /msg dpkg installer firmware and see the wiki page above. |
| 17:30.13 | *** join/#debian extor (~extor@c-76-16-36-19.hsd1.il.comcast.net) |
| 17:30.44 | *** join/#debian Ricardo__ (~rick@187.107.20.138) |
| 17:31.01 | *** mode/#debian [+l 1152] by debhelper |
| 17:31.19 | webad_13 | I have hidden grub menu - but even though I hold shift at boot menu is not displayed so that I could edit quickly to add one option when conditions are right |
| 17:31.26 | *** join/#debian dArK_IcE (~lawl@a79-168-125-137.cpe.netcabo.pt) |
| 17:31.33 | webad_13 | this is my /etc/default/grub http://pastebin.com/q3jasedD |
| 17:31.49 | cataliyst | jhutchins_lt: ok, let see what can I do,, :) thanks |
| 17:32.10 | *** join/#debian willemw (~willem@145.116.231.166) |
| 17:33.16 | *** join/#debian sacredchao (debian-tor@gateway/tor-sasl/nike) |
| 17:33.53 | *** join/#debian pzn (~pzn@pdpc/supporter/active/pzn) |
| 17:34.28 | pzn | need a hint about a program to "resize" a pdf by 90% and output a new pdf file. any hint of a package? |
| 17:34.57 | justin_ | pzn: tried convert ? |
| 17:34.59 | pipeline | pzn: texlive-* |
| 17:35.03 | pipeline | pzn: pdfcrop can do that |
| 17:35.40 | pipeline | pzn: pdftk, from the package of the same name, can also do it... and it's a lot fastert than the tex tools. But the tex tools will do a lot more than just crop/resize to your pdf if you want. |
| 17:35.47 | cataliyst | jhutchins_lt: http://wiki.debian.org/Firmware, it is all the firmware supported by debian? |
| 17:36.02 | themill | pipeline: it can? |
| 17:36.27 | cataliyst | jhutchins_lt: my server ask for megaraid driver |
| 17:36.41 | pipeline | themill: iirc yes |
| 17:36.46 | pipeline | themill: <3 pdftk |
| 17:36.52 | jhutchins_lt | That should be easy enough to find. That's what I suspected. |
| 17:36.59 | themill | pipeline: I can't find that anywhere in the man page, that's why I ask. |
| 17:37.27 | pipeline | themill: I do not presently have it installed, but a major thing I used pdftk for was reformatting PDFs for use on my kindle dx (controlling size, whitespace) |
| 17:37.28 | *** join/#debian eft_ (~opera@static-67-226-141-51.ptr.terago.net) |
| 17:37.33 | pipeline | themill: so there's a way to do something along tose lines :P |
| 17:37.36 | pzn | justin_, pipeline: thanks! trying your suggestions |
| 17:38.21 | *** join/#debian gusto (~gusto@p4FFE724C.dip.t-dialin.net) |
| 17:39.41 | cataliyst | my opinion is that my server need some hard drive controller, but I can't find firmware match such criteria |
| 17:39.52 | *** part/#debian gjs (~gjs@GSWoT/Member/gjs) |
| 17:39.52 | *** join/#debian DaZ (~meh@77-254-37-158.adsl.inetia.pl) |
| 17:40.59 | justin_ | cataliyst: didn't you say it worked if you set it to raid0? |
| 17:42.00 | *** join/#debian Brigo (~Brigo@139.182.60.213.dynamic.mundo-r.com) |
| 17:42.22 | cataliyst | yes, but I prefer not to use RAID |
| 17:42.22 | *** join/#debian cga (~cga@82.84.190.164) |
| 17:42.38 | justin_ | cataliyst: what is it set to NOW? |
| 17:42.57 | cataliyst | I read some article that using RAID may decrease I/O performance |
| 17:43.08 | abrotman | cataliyst: depends which type of RAID you use |
| 17:43.23 | abrotman | and which part of IO you're measuring |
| 17:44.12 | cataliyst | I tested it by using mysql |
| 17:44.34 | cataliyst | IBM 3620 m3 vs my PC core-i3 |
| 17:44.40 | *** join/#debian format_c (~format_c@2001:4dd0:fc0c:0:6e62:6dff:fe4a:e47d) |
| 17:44.48 | cataliyst | 7minute vs 30 second |
| 17:45.21 | twobitsprite | stares blankly at cataliyst |
| 17:45.46 | justin_ | cataliyst: well then it's settled, give your IBM server to someone who can use it, and run your website on your PC |
| 17:45.55 | *** join/#debian wissem (~wissem@unaffiliated/wissem) |
| 17:45.57 | twobitsprite | justin_: +1 |
| 17:46.03 | justin_ | you're using mysql so it can't be all that important anyway |
| 17:47.28 | *** join/#debian BladeFreak (~BladeFrea@unaffiliated/bladefreak) |
| 17:47.55 | *** join/#debian Gottaname (~Gottaname@bb116-15-183-47.singnet.com.sg) |
| 17:48.21 | *** join/#debian bonjoyee (~squeeze@117.204.167.102) |
| 17:48.46 | *** join/#debian jalalsfs (~jalal@unaffiliated/jalalsfs) |
| 17:48.56 | jhutchins_lt | justin_: That's so helpful and compassionate. |
| 17:49.19 | bonjoyee | whenever i have KMS enabled..my screen flickers at login and also intermittently..anyone noticed this? |
| 17:49.24 | *** join/#debian skrewler (~skrewler@209.213.206.58) |
| 17:49.25 | twobitsprite | cataliyst: which do you think is a more likely scenario: 1) that major businesses pay big money for IBM servers so they can have something that runs 14 times slower than their PC, or 2) you don't know how to configure raid? |
| 17:50.11 | bonjoyee | i have ati radeon x1250 with default radeon driver....on debian squeeze 64bit |
| 17:51.21 | *** join/#debian EduardeCalibal (~Eduarde@novoseusadosinformatica.com.br) |
| 17:53.19 | *** join/#debian mekeor (~chatzilla@dslb-088-067-133-071.pools.arcor-ip.net) |
| 17:53.36 | *** join/#debian acemi (~acemi@unaffiliated/acemi) |
| 17:54.11 | *** join/#debian format_c (~format_c@dslb-188-097-160-014.pools.arcor-ip.net) |
| 17:54.27 | jhutchins_lt | bonjoyee: Sounds like a sync issue with your monitor. |
| 17:55.06 | bonjoyee | jhutchins_lt: any fixes? tests? |
| 17:55.42 | jhutchins_lt | bonjoyee: Change the frequencies. |
| 17:55.57 | bonjoyee | jhutchins_lt: also the issues goes away completely when booted with radeon.modeset=0 |
| 17:56.27 | bonjoyee | jhutchins_lt: currently its at 1440x900@75 |
| 17:56.52 | *** join/#debian githogori (~githogori@216.207.36.222) |
| 17:57.05 | jhutchins_lt | bonjoyee: So turn off kms. |
| 17:57.15 | *** join/#debian Alam_Squeeze (~alam@rigginstereo.lawarias.srb2.org) |
| 17:57.50 | bonjoyee | jhutchins_lt: yeah..but would i miss anything? what the basic purpose of kms? |
| 17:59.02 | jhutchins_lt | I doubt you'd miss it in ordinary use. It may have some advanced applications in 3D acceleration, but I don't have enough knowledge to adequately explain it. |
| 17:59.40 | bonjoyee | jhutchins_lt: ok ..thanks.. |
| 17:59.42 | *** part/#debian eft_ (~opera@static-67-226-141-51.ptr.terago.net) |
| 17:59.43 | *** join/#debian gusto (~gusto@p4FFE724C.dip.t-dialin.net) |
| 17:59.48 | pipeline | bonjoyee: the ultimate purpose of kms is to make things simpler |
| 18:00.00 | bonjoyee | pipeline: like? |
| 18:00.04 | pipeline | bonjoyee: right now it is not making your life simpler, so turn it off, verify that suspend/resume still work, and then never worry about it again |
| 18:00.41 | pipeline | bonjoyee: right now having userspace processes set the graphics mode requires backwards handsprings giving userspace nasty gross access to hardware. kernel mode setting may not fix any security issues there but it will certainly get rid of the handsprings :P |
| 18:00.41 | bonjoyee | pipeline: suspend works like a charm...even from s3/s5... |
| 18:01.21 | mekeor | how can i load a module "automatically" on startup? |
| 18:01.33 | *** join/#debian zelda (75c07b10@gateway/web/freenode/ip.117.192.123.16) |
| 18:01.41 | zelda | I did a forced "fsck" on reboot, and already rebooted, are there any logs saved about that fsck run anywhere? |
| 18:01.58 | *** join/#debian PhoenixSTF (~PhoenixST@213-205-82-2.static.net.novis.pt) |
| 18:02.00 | wols_ | mekeor: putit in /etc/modules? |
| 18:02.03 | *** join/#debian githogori_ (~githogori@216.207.36.222) |
| 18:02.17 | *** part/#debian bonjoyee (~squeeze@117.204.167.102) |
| 18:02.33 | *** join/#debian jazz (~Adium@vaala.mine.nu) |
| 18:02.53 | *** join/#debian rage7 (~rage@val59-5-88-172-75-180.fbx.proxad.net) |
| 18:03.21 | mekeor | wols_: thx very much |
| 18:05.32 | *** join/#debian rafuch0 (~flux@190.38.228.128) |
| 18:06.10 | *** join/#debian Gottaname (~Gottaname@bb116-15-183-47.singnet.com.sg) |
| 18:07.32 | *** join/#debian stevieman (~Longfield@dynamic-66-102-71-5.wtccommunications.ca) |
| 18:07.56 | *** join/#debian muneeb (~muneeb@123.237.70.69) |
| 18:08.15 | stevieman | Is there a good How-to for setting up printing on samba? My google searches are turning up so preety nasty steps |
| 18:08.20 | *** join/#debian davidisko (~davidisko@nat-88-212-37-51.antik.sk) |
| 18:08.53 | *** part/#debian mekeor (~chatzilla@dslb-088-067-133-071.pools.arcor-ip.net) |
| 18:09.00 | *** join/#debian r3c4ll (~r3c4ll@190.77.235.170) |
| 18:09.02 | justin_ | stevieman: setup cups |
| 18:11.01 | *** mode/#debian [+l 1144] by debhelper |
| 18:11.03 | *** join/#debian bronaugh (bronaugh@devel2.pcic.uvic.ca) |
| 18:11.14 | *** join/#debian nadar (~nobody@p54B48EA3.dip0.t-ipconnect.de) |
| 18:12.22 | *** join/#debian geekosopher (~nitesh@unaffiliated/mistrynitesh) |
| 18:12.33 | *** join/#debian cafaro_ (~cafaro@unaffiliated/cafaro) |
| 18:14.30 | Saar | does someone know why in squeeze gnome stock items in the panel, i.e. menu item pictures such as for the "about" item, have partially disappeared? |
| 18:14.53 | *** join/#debian robertdavid (~Robert@gate.chabry.cz) |
| 18:14.58 | Saar | the same applets on lenny show the menu item pictures, or icons, but on squeeze they're gone |
| 18:15.25 | *** join/#debian Python132O (Python1320@2001:470:dd3b:1337:50b1:ee99:6820:50d1) |
| 18:15.25 | *** join/#debian Python132O (Python1320@unaffiliated/python1320) |
| 18:15.36 | *** part/#debian zelda (75c07b10@gateway/web/freenode/ip.117.192.123.16) |
| 18:15.40 | *** join/#debian Python132O (Python1320@2001:470:dd3b:1337:50b1:ee99:6820:50d1) |
| 18:15.40 | *** join/#debian Python132O (Python1320@unaffiliated/python1320) |
| 18:16.21 | *** join/#debian m4ggus (~m4ggus@p5DD53F13.dip.t-dialin.net) |
| 18:16.47 | karlpinc_ | stevieman: Once your you have cups working you edit /etc/smb.conf (IIRC) and just turn on printer sharing. It's one line. ( |
| 18:16.52 | karlpinc_ | then restart smb) |
| 18:17.12 | karlpinc_ | stevieman: That said. I always poke it with a stick until it works. I forget the details. |
| 18:17.22 | *** join/#debian vokoda (~user@unaffiliated/vokoda) |
| 18:18.41 | *** join/#debian ring1 (~ring0@unaffiliated/ring0) |
| 18:20.07 | *** part/#debian dawud (~dawud@229.144.217.87.dynamic.jazztel.es) |
| 18:20.13 | MartyD | Hi guys! Can someone point me towards mounting AFP-shares on Squeeze? I've only installed Netatalk so far and I would like something like a Gnome applet or something other graphical to mount those shares |
| 18:20.46 | *** join/#debian zelda (75c07b10@gateway/web/freenode/ip.117.192.123.16) |
| 18:21.38 | *** join/#debian ealdor (~ealdor@180.Red-79-156-131.staticIP.rima-tde.net) |
| 18:22.21 | *** join/#debian AbsintheSyringe (~havoc@91.82.208.3) |
| 18:22.46 | justin_ | MartyD: why are you using AFP? |
| 18:23.11 | MartyD | justin_: because I want to access the shares from Macs in our network |
| 18:23.30 | justin_ | macs support NFS and SMB |
| 18:23.52 | MartyD | sure, but AFP performs 10 times better between macs than smb or something else |
| 18:23.54 | *** join/#debian [SkG] (~SkG@unaffiliated/skg/x-897332) |
| 18:24.09 | MartyD | also, macos 10.7 will drop smb |
| 18:24.11 | *** join/#debian batchy (~batchy@81-64-253-236.rev.numericable.fr) |
| 18:24.24 | stevieman | karlpinc_: I just realised that the printer is a network printer, can I share a network printer with Samba? |
| 18:24.29 | MartyD | and I wanna be prepared when that happens |
| 18:25.31 | CyL | !broadcom |
| 18:25.31 | dpkg | Broadcom Corporation is an integrated circuits supplier. For wireless LAN chipset drivers, ask me about <b43>, <brcm80211>, <wl>. For Ethernet chipset support, ask me about <bnx2>, <bnx2x>, <tg3>. |
| 18:25.54 | Nu^253r | !ralink |
| 18:25.54 | dpkg | Ralink Technology Corp. is a wireless LAN chipset manufacturer. Drivers for many Ralink chipsets are present in mainline Linux kernels, ask me about <rt2x00>. For support of 802.11n devices, ask me about <rt2800>. |
| 18:26.17 | *** join/#debian chellomere (~alex@h-234-42.A189.priv.bahnhof.se) |
| 18:26.53 | justin_ | MartyD: samba != smb |
| 18:27.26 | *** join/#debian sgran (steve@gw.lobefin.net) |
| 18:27.32 | Nu^253r | !rt2800pci |
| 18:27.33 | dpkg | Ralink 802.11n PCI chipsets (RT2760, RT2790, RT2860, RT2880, RT2890, RT3090, RT3091, RT3092) are supported by the rt2x00 project's rt2800pci driver, included in the mainline Linux kernel since 2.6.33. Firmware is required, ask me about <ralink firmware> to provide. http://wireless.kernel.org/en/users/Drivers/rt2800pci . For the vendor driver (amd64, i386 only), ask me about <rt2860sta>. |
| 18:27.43 | MartyD | justin_: where di I say Samba?? Anyways, arguing will not help me, thanks! |
| 18:27.59 | *** part/#debian sgran (steve@gw.lobefin.net) |
| 18:28.02 | *** part/#debian binbrain (~binbrain@office.quietcaresystems.com) |
| 18:28.07 | abrotman | Nu^253r: you can msg the bot |
| 18:28.15 | justin_ | MartyD: you didn't, which was your mistake. Apple is removing samba, not SMB support |
| 18:28.57 | Nu^253r | abrotman `' thanx for the info, and sorry for flooding :s |
| 18:29.12 | *** join/#debian movl (~movl@89.47.83.116) |
| 18:29.31 | MartyD | justin_: nvm please |
| 18:30.16 | *** join/#debian HackeMate (~hXm@107.Red-88-9-181.dynamicIP.rima-tde.net) |
| 18:30.33 | *** join/#debian trurl (~trurl@2a00:1828:2000:59::23) |
| 18:30.34 | *** join/#debian derchris (~derchris@78-86-128-162.zone2.bethere.co.uk) |
| 18:31.47 | *** join/#debian ricardo (~ricardo@189.193.6.179) |
| 18:31.51 | ricardo | hi |
| 18:31.57 | ricardo | I have a problem with my headphones on debian linux mint, can you help? |
| 18:32.16 | justin_ | !+mint |
| 18:32.16 | dpkg | Linux Mint is not Debian and is not supported in #debian. Please use their forums at http://forums.linuxmint.com/ or join #linuxmint-help on irc.spotchat.org for support. Linux Mint is variously based on <Ubuntu> with a "Linux Mint Debian Edition" (LMDE) also available, based on <testing>. See also <based on debian>, <mintppc>. |
| 18:32.56 | *** join/#debian chellomere (~alex@h-234-42.A189.priv.bahnhof.se) |
| 18:33.22 | MartyD | justin_: samba and smb means the same to me, also I've had too many issues with filenames etc between my deb box and windows shares |
| 18:33.41 | MartyD | justin_: So there is no hope for me accessing afp shares? |
| 18:33.48 | justin_ | MartyD: samba is a specific implementation of the smb protocol |
| 18:34.07 | *** join/#debian safejav (~safejav@190.189.210.146) |
| 18:34.36 | justin_ | MartyD: I wouldn't bother with AFP. |
| 18:34.45 | *** join/#debian chaisen (~chaisen@p4FD48884.dip0.t-ipconnect.de) |
| 18:35.30 | MartyD | justin_: okay thanks for your opinion, but as smb or samba is a security risc on macs I'll continue looking for a solution. |
| 18:36.15 | *** join/#debian twinkie_addict (~twinkie@adsl-216-78-223-47.sdf.bellsouth.net) |
| 18:36.33 | justin_ | MartyD: security risk? |
| 18:37.10 | MartyD | justin_: yes, even the OS itself mentions this when you enable SMB on a Mac |
| 18:37.24 | *** join/#debian dawud (~dawud@229.144.217.87.dynamic.jazztel.es) |
| 18:37.38 | *** join/#debian githogori_ (~githogori@216.207.36.222) |
| 18:38.11 | *** join/#debian gnugr (~gnugr@athedsl-214168.home.otenet.gr) |
| 18:38.27 | justin_ | MartyD: what does it say? |
| 18:38.38 | *** join/#debian Coweater (~coweater@pool-173-74-130-28.dllstx.fios.verizon.net) |
| 18:38.47 | *** join/#debian babilen (~babilen@unaffiliated/babilen) |
| 18:38.53 | MartyD | justin_: I'd have to translate from german.. lemme have a look at it |
| 18:38.55 | *** join/#debian githogori (~githogori@216.207.36.222) |
| 18:39.13 | *** join/#debian sechrist_ (~sechrist@c-69-181-226-178.hsd1.ca.comcast.net) |
| 18:40.17 | MartyD | justin_: It's basically a warning that if you enable SMB the required user password will be stored in a "unsafe way" on this Mac |
| 18:40.35 | MartyD | justin_: sounds like plaintext to me |
| 18:40.55 | *** join/#debian berserkr (~david@48.197.222.87.dynamic.jazztel.es) |
| 18:41.02 | justin_ | MartyD: oh, it's not plaintext, it's just less secure than other encryption mechanisms |
| 18:41.31 | rgr | yes it is plaintext I thought |
| 18:42.15 | MartyD | justin_: okay, but then.. the performance problem still exists, and that's why I wanted to try AFP from my Debian box and see if it's any faster than SMB |
| 18:42.26 | *** join/#debian axelis (~axelis@ppp-94-68-98-149.home.otenet.gr) |
| 18:42.31 | justin_ | samba is plenty fast enough |
| 18:42.50 | abrotman | think 'salted' IIRC |
| 18:42.52 | justin_ | really on any modern system you should be able to saturate a gig network using any protocol |
| 18:43.36 | MartyD | justin_: okay but why do I get 25mb over gigabit with SMB and 85+ with AFP? |
| 18:43.59 | justin_ | MartyD: tuning, probably |
| 18:44.12 | MartyD | justin_: IMHO this tells me the SMB implementation on Macs is crappy |
| 18:44.17 | justin_ | oh, that could be :) |
| 18:44.27 | *** join/#debian m1ndvirus (m1ndvirus@unaffiliated/mindvirus) |
| 18:44.39 | *** join/#debian dgm_077 (~dgm_077@port-92-206-62-31.dynamic.qsc.de) |
| 18:44.40 | MartyD | I think so, got it confirmed by a few other mac users |
| 18:44.48 | m1ndvirus | Hi. I'm trying to set up NFS but I'm afraid my client machine doesn't see my server machine serving :2049. Any ideas? |
| 18:44.56 | *** join/#debian gnufreex_ (~quassel@79-101-191-109.dynamic.isp.telekom.rs) |
| 18:44.57 | justin_ | m1ndvirus: see? |
| 18:45.00 | *** join/#debian syslq (~syslq@91.185.207.168) |
| 18:45.05 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 18:45.10 | m1ndvirus | justin_: ? |
| 18:45.27 | m1ndvirus | The server is definitely running on :2049. |
| 18:45.32 | justin_ | m1ndvirus: I doubt your client "sees" anything |
| 18:45.33 | m1ndvirus | But the client definitely can't access it. |
| 18:45.50 | m1ndvirus | justin_: "see" has many definitions. |
| 18:46.06 | justin_ | m1ndvirus: none of which are helpful when troubleshooting :) |
| 18:46.14 | rgr | he's being a clever pants. Its quite clear what you mean. |
| 18:46.25 | *** part/#debian rgr (~user@85.183.18.158) |
| 18:46.27 | MartyD | m1ndvirus: justin_ is a picky one when it comes to proper definitions ;) *grin* |
| 18:46.43 | justin_ | it's really not. an error message is clear, a log message is clear, an expected outcome is clear |
| 18:46.46 | *** join/#debian RobinJ (~Robin@unaffiliated/robinj) |
| 18:47.03 | m1ndvirus | That's fine and dandy as long as I solve this problem. |
| 18:47.09 | justin_ | what problem? |
| 18:47.16 | MartyD | I thought so too LMAO |
| 18:47.35 | m1ndvirus | [14:45] <m1ndvirus> The server is definitely running on :2049. |
| 18:47.35 | m1ndvirus | [14:45] <m1ndvirus> But the client definitely can't access it. |
| 18:47.42 | justin_ | why can't it? |
| 18:47.57 | *** part/#debian willemw (~willem@145.116.231.166) |
| 18:48.04 | RobinJ | help |
| 18:48.38 | m1ndvirus | justin_: That's why I'm here. |
| 18:48.44 | m1ndvirus | I didn't configure the machine. |
| 18:49.18 | twobitsprite | RobinJ: OK |
| 18:49.24 | twobitsprite | help RobinJ |
| 18:49.37 | MartyD | call 110 |
| 18:49.43 | abrotman | m1ndvirus: listening on which IP with port 2049 ? |
| 18:50.05 | m1ndvirus | Not going to say. |
| 18:50.47 | abrotman | m1ndvirus: is it a public IP or 0.0.0.0 or 127.0.0.1 ? |
| 18:50.50 | *** join/#debian spal (~susam@pdpc/supporter/active/spal) |
| 18:51.01 | m1ndvirus | It's an IP specific to the client. |
| 18:51.11 | m1ndvirus | The server can access the client and vice-versa. |
| 18:51.12 | justin_ | m1ndvirus: and WHY do you say that it can't access it? |
| 18:51.25 | MartyD | m1ndvirus: Is it behind a router? port-forwarding might help then |
| 18:51.26 | m1ndvirus | Because nmap <serverip> from the client doesn't show 2049. |
| 18:51.34 | justin_ | m1ndvirus: nmap is not an NFS client |
| 18:51.37 | jelly-home | m1ndvirus: are there any firewalls in between |
| 18:51.57 | m1ndvirus | jelly-home: Most likely. |
| 18:52.04 | m1ndvirus | justin_: You're right, but it's a diagnostic tool. |
| 18:52.06 | jelly-home | m1ndvirus: um, get rid of them? |
| 18:52.10 | m1ndvirus | HELL no. |
| 18:52.13 | m1ndvirus | This is a production machine. |
| 18:52.18 | twobitsprite | m1ndvirus: try rpcinfo or something more usefull |
| 18:52.39 | abrotman | he's trying to nfs over the intarweb? |
| 18:52.42 | jelly-home | shrug |
| 18:52.46 | m1ndvirus | No. |
| 18:52.48 | m1ndvirus | It's a local network. |
| 18:52.49 | justin_ | abrotman: who knows. They can't "see" each other |
| 18:53.00 | webad_13 | could someone help me with this - I am unable to access grub menu by holding shift if I enable hidden menu... this is my /etc/default/grub http://pastebin.com/q3jasedD |
| 18:53.10 | abrotman | why won't he show us the IP if it's a local network? |
| 18:53.15 | *** join/#debian gusnan (~gusnan@h114n7c1o269.bredband.skanova.com) |
| 18:53.21 | *** join/#debian tvm (~tvm@router-vinice.pilsfree.net) |
| 18:53.28 | justin_ | webad_13: does escape work? |
| 18:53.30 | *** join/#debian phantomcircuit (~phantomci@2001:470:1f05:848:4687:fcff:fedb:8a6c) |
| 18:53.35 | MartyD | abrotman: lol, oh soo true! |
| 18:53.53 | m1ndvirus | abrotman: Because it's a public IP mapped to a computer on a local network. |
| 18:53.59 | webad_13 | justin_, u c I haven't tried that - it is grub2 so I think they changed it to shift |
| 18:54.08 | webad_13 | but it doesn't hurt to try with esc |
| 18:54.08 | m1ndvirus | A computer has multiple IPs. |
| 18:54.22 | m1ndvirus | I really need to solve this problem. Any advice would be greatly appreciated. |
| 18:54.26 | twobitsprite | m1ndvirus: if you're accessing it over the public IP, then you are routing over the public interface, therefore it's not a local network |
| 18:54.42 | twobitsprite | m1ndvirus: so, what exactly happens when you try to mount the nfs export? |
| 18:55.01 | m1ndvirus | twobitsprite: EXCELLENT question. $ sudo mount Datastore |
| 18:55.02 | m1ndvirus | mount.nfs: mount system call failed |
| 18:55.24 | *** join/#debian NeoBlaster (~N3oBl@st3r.net) |
| 18:55.37 | justin_ | one should not start with mount, one should start with showmount -e |
| 18:55.53 | twobitsprite | justin_: that's what I was going to ask next |
| 18:56.04 | m1ndvirus | On the client? |
| 18:56.06 | *** join/#debian usr13 (~terry@74.113.242.5) |
| 18:56.06 | twobitsprite | but showmount can fail where a mount might, sometimes |
| 18:56.13 | twobitsprite | might not* |
| 18:56.16 | *** join/#debian sphenxes01 (~sphenxes0@85-127-213-25.dynamic.xdsl-line.inode.at) |
| 18:56.22 | *** join/#debian Coweater (~coweater@pool-173-74-130-28.dllstx.fios.verizon.net) |
| 18:56.42 | m1ndvirus | justin_: On the client: clnt_create: RPC: Program not registered |
| 18:57.02 | twobitsprite | m1ndvirus: do you have portmapper running on the server? |
| 18:57.10 | m1ndvirus | Possibly. How do I find out? |
| 18:57.34 | twobitsprite | rpcinfo -p |
| 18:57.45 | m1ndvirus | twobitsprite: Yes. |
| 18:58.04 | twobitsprite | port 111 tcp and udp? |
| 18:58.10 | *** join/#debian centHOGG (~centHOGG@adsl-67-67-223-157.dsl.austtx.swbell.net) |
| 18:58.11 | m1ndvirus | twobitsprite: Yep. |
| 18:58.21 | *** join/#debian debsan (~debsan@190.245.74.16) |
| 18:58.30 | m1ndvirus | What does that tell you? |
| 18:59.24 | twobitsprite | now try "rpcinfo -p <server>" from the client |
| 18:59.49 | m1ndvirus | Wait, I ran that on the client. |
| 18:59.52 | m1ndvirus | Should I have ran that on the server? |
| 19:00.09 | twobitsprite | ohh, I assumed you would... but doesn't really matter... run it from the client and point it at the server |
| 19:00.43 | m1ndvirus | rpcinfo: can't contact portmapper: RPC: Remote system error - No route to host |
| 19:01.12 | twobitsprite | is your server on the same subnet as your client? |
| 19:01.20 | *** join/#debian angus_ (~angus_@92.81.11.42) |
| 19:01.36 | m1ndvirus | It's one IP away. |
| 19:01.40 | usr13 | m1ndvirus: I think he wants you to run rpcinfo -p <servers-IP> from the client. |
| 19:01.48 | jelly-home | fix your firewall settings. |
| 19:01.48 | m1ndvirus | That's what I did. |
| 19:01.55 | m1ndvirus | On client or server? |
| 19:01.57 | jelly-home | both. |
| 19:02.06 | m1ndvirus | I didn't set 'em up! |
| 19:02.28 | jelly-home | doesn't really matter who set them up does it |
| 19:02.33 | twobitsprite | can you connect to anything else on that server from that client? ssh? etc? |
| 19:02.42 | m1ndvirus | It does if I am to fix it. |
| 19:02.49 | m1ndvirus | twobitsprite: SSH works. |
| 19:03.06 | twobitsprite | m1ndvirus: to the *exact same* IP address? Not a different address on the same server |
| 19:03.32 | m1ndvirus | twobitsprite: Yes. |
| 19:03.39 | m1ndvirus | It DEFINITELY works. |
| 19:03.42 | *** join/#debian cbecht (~cbecht@c-24-99-71-250.hsd1.ga.comcast.net) |
| 19:03.54 | justin_ | well, it clearly doesn't work :) |
| 19:04.01 | m1ndvirus | SSH does. |
| 19:04.06 | m1ndvirus | It is ambiguous. |
| 19:04.13 | twobitsprite | I don't know how you can ssh to it, but get no route to host when doing rpcinfo |
| 19:04.15 | *** join/#debian xrl (u1091@gateway/web/irccloud.com/x-hkeimihfbzddxjoo) |
| 19:04.26 | justin_ | twobitsprite: depends on the firewall in the middle |
| 19:04.38 | m1ndvirus | Using iptables. |
| 19:04.49 | *** join/#debian debsan (~debsan@190.245.74.16) |
| 19:04.55 | *** join/#debian robo (~robo@vpn.homes.com) |
| 19:04.57 | twobitsprite | justin_: firewall shouldn't stop it from routing... at worst you should get a timeout |
| 19:05.15 | *** join/#debian sourcode (~code@ppp-58-8-154-193.revip2.asianet.co.th) |
| 19:05.17 | twobitsprite | I mean, either the math works on the netmasks or it doesn't |
| 19:05.20 | justin_ | twobitsprite: 'no route to host' can come from the firewall |
| 19:05.30 | *** join/#debian CyberGabber (~CyberGabb@31-183-ftth.onsbrabantnet.nl) |
| 19:05.31 | twobitsprite | hmm... I've never seen that before |
| 19:05.34 | *** join/#debian Spec (~nwheeler@unaffiliated/spec) |
| 19:05.45 | *** join/#debian chaisen (~chaisen@p4FD48884.dip0.t-ipconnect.de) |
| 19:05.49 | twobitsprite | maybe if it's a NAT'ing firewall... |
| 19:06.03 | justin_ | no, nothing to do with nat |
| 19:06.04 | m1ndvirus | I have a feeling it is. |
| 19:06.23 | *** join/#debian lanthan (~ze@p54B7D559.dip.t-dialin.net) |
| 19:06.26 | justin_ | google "broctl check 2>&1 |grep error && {echo "Config error";echo "exit"} |
| 19:06.27 | justin_ | er |
| 19:06.33 | justin_ | google "nfs client no route to host firewall" |
| 19:07.04 | m1ndvirus | If I am not mistaken NFS has nothing to do with it. |
| 19:07.15 | justin_ | you're the one with the NFS problem :) |
| 19:07.29 | m1ndvirus | I am sentient and have input into the matter. |
| 19:07.35 | m1ndvirus | At this point :2049 is just another port. |
| 19:07.43 | *** join/#debian Cryp71c (~rburnham@adsl-065-013-247-238.sip.bna.bellsouth.net) |
| 19:07.48 | justin_ | if ssh works and you didn't somehow break NFS and there if a firewall in the middle, the firewall in the middle is likely your problem |
| 19:07.51 | m1ndvirus | All I want to do right now is create a connection between server's 2049 and client. |
| 19:08.02 | m1ndvirus | justin_: Agreed. |
| 19:08.10 | *** join/#debian blast_hardcheese (~blast_har@cpe-98-154-59-208.socal.res.rr.com) |
| 19:08.11 | m1ndvirus | Would you like to see my firewall configuration? |
| 19:08.14 | twobitsprite | justin_: ok, fair enough, I stand corrected |
| 19:08.17 | Cryp71c | Grrr, installing some wireless drivers for the notorious bcm43xx line of wireless chipsets. Everything is done, dmesg is reporting some stuff about "kernel taint" |
| 19:08.30 | justin_ | m1ndvirus: I thought you said you didn't setup the firewall |
| 19:08.30 | usr13 | m1ndvirus: exportfs -a -v #On the server. What does that say? |
| 19:08.36 | *** join/#debian _thalamus (~thalamus@81-179-4-130.dsl.pipex.com) |
| 19:08.39 | m1ndvirus | justin_: I didn't. |
| 19:08.41 | m1ndvirus | Someone else did. |
| 19:08.43 | centHOGG | b43fwcutter |
| 19:08.53 | m1ndvirus | justin_: This is a production server. |
| 19:09.21 | *** join/#debian lanthan (~ze@p54B7D559.dip.t-dialin.net) |
| 19:09.29 | Cryp71c | centHOGG: ? |
| 19:09.31 | m1ndvirus | usr13: exporting <clientip>:/export/Datastore |
| 19:09.41 | centHOGG | yeah, apt-cache search b43 |
| 19:09.49 | usr13 | exportfs -a -v should say that it is .... ok good that part is working... so. |
| 19:10.17 | twobitsprite | usr13: I think we've already determined the proble is his firewall, not his exports list |
| 19:10.33 | Cryp71c | centHOGG: I'm using crunchbang linux, it actually has b43 (though IDK what version) but its behaving VERY eratically (disconnects on most networks, especially if the signal is even below "mediocre"). |
| 19:10.36 | usr13 | twobitsprite: Ok... yea, I came on here late.. just checking. |
| 19:10.41 | twobitsprite | usr13: :) |
| 19:11.16 | centHOGG | idk, I know to work debian/ubuntu you have to install that b43fwcutter |
| 19:11.19 | m1ndvirus | So how do I fix this firewall problem? |
| 19:11.49 | *** join/#debian chaisen (~chaisen@p4FD48884.dip0.t-ipconnect.de) |
| 19:11.56 | twobitsprite | !tell m1ndvirus about iptables |
| 19:12.01 | *** join/#debian Ramblurr (~rmblr@amarok/developer/Ramblurr) |
| 19:12.08 | twobitsprite | Cryp71c: try #crunchbang |
| 19:12.47 | centHOGG | sudo iptables -L |
| 19:12.48 | m1ndvirus | twobitsprite: So, you're sending me to #netfilter? |
| 19:13.04 | twobitsprite | m1ndvirus: well... there are docs listed there too |
| 19:13.11 | twobitsprite | m1ndvirus: i.e., I'm telling you to rtfm :) |
| 19:13.17 | *** join/#debian feisar (~simon@60.139.187.81.in-addr.arpa) |
| 19:13.32 | m1ndvirus | twobitsprite: But the problem is definitely firewall? |
| 19:13.33 | centHOGG | install nmap for gawdsakes |
| 19:13.44 | m1ndvirus | centHOGG: talking to me? |
| 19:13.56 | twobitsprite | m1ndvirus: I would say so... or, at least allow the appropriate ports on your firewall and see if it works |
| 19:14.08 | *** join/#debian chaisen (~chaisen@p4FD48884.dip0.t-ipconnect.de) |
| 19:14.20 | m1ndvirus | twobitsprite: The biggest concern I have is not fucking up existing configs. |
| 19:14.32 | *** join/#debian sourcode_ (~code@ppp-58-8-154-193.revip2.asianet.co.th) |
| 19:14.53 | centHOGG | sudo nmap -sT localhost (to see what's listening) |
| 19:15.02 | *** join/#debian mshindo (~mshindo@203-114-166-191.dsl.sta.inspire.net.nz) |
| 19:15.13 | m1ndvirus | centHOGG: It's definitely listening. |
| 19:15.22 | centHOGG | k |
| 19:15.29 | centHOGG | what port are you after |
| 19:15.32 | m1ndvirus | :2049. |
| 19:15.58 | wols_ | centHOGG: nmap is a totally useless thing to check what at what ports something is listening. especially when you probe localhost only |
| 19:16.01 | *** join/#debian doleyb (~pwickis@pool-173-76-249-18.bstnma.fios.verizon.net) |
| 19:16.01 | centHOGG | ping whatever:2049 does what? |
| 19:16.17 | centHOGG | sure |
| 19:16.28 | justin_ | ping whatever:2049 gives an error that whatever:2049 is not a valid hostname |
| 19:16.30 | m1ndvirus | ping: unknown host <blah>:2049 |
| 19:16.42 | centHOGG | k |
| 19:16.51 | centHOGG | how do you DNS |
| 19:17.02 | wols_ | centHOGG: please stop |
| 19:17.02 | centHOGG | router or router box |
| 19:17.13 | centHOGG | k |
| 19:17.24 | m1ndvirus | Haha wow. |
| 19:17.28 | jelly-home | m1ndvirus: it might be useful to pastebin iptables-save output from the server (and, why not, the client as well) |
| 19:18.12 | m1ndvirus | http://paste.pocoo.org/show/Y6Np4RrQHZ9qCRG6QLTR/ |
| 19:18.17 | m1ndvirus | Server's config. |
| 19:18.49 | jelly-home | but not iptables-save |
| 19:18.55 | m1ndvirus | Does it matter? |
| 19:19.01 | m1ndvirus | I already pastebinned this one. |
| 19:19.07 | *** join/#debian salahuddin66 (~pasha@180.211.165.254) |
| 19:19.11 | *** join/#debian r3c4ll (~r3c4ll@190.77.235.170) |
| 19:19.15 | jelly-home | all the resolved IPs make it unreadable |
| 19:19.24 | m1ndvirus | OK one second. |
| 19:19.39 | m1ndvirus | What's the best way to do this? |
| 19:19.47 | *** join/#debian zamberlan (~zamberlan@200.241.78.18) |
| 19:19.52 | jelly-home | just run iptables-save |
| 19:20.03 | jelly-home | it dumps to stdout |
| 19:20.03 | *** join/#debian buhman (~zack@unaffiliated/zjblabs) |
| 19:20.04 | m1ndvirus | jelly-home: This is a production server. I don't like 'save'. |
| 19:20.10 | m1ndvirus | Oh cool. |
| 19:20.14 | m1ndvirus | So no saving occurs? |
| 19:20.15 | jelly-home | m1ndvirus: it doesn't DO ANYTHING |
| 19:20.20 | m1ndvirus | Nice. |
| 19:20.35 | justin_ | m1ndvirus: that's a production server, and you have the memached port open to everyone? |
| 19:20.47 | m1ndvirus | Lucky for me I didn't configure that one. |
| 19:20.51 | jelly-home | if you "don't like", read the docs to see if we're telling you to do something harmful |
| 19:21.04 | *** join/#debian connor_ (~connor@ip72-204-33-197.fv.ks.cox.net) |
| 19:21.06 | *** join/#debian gremset (ubuntu@117.192.123.16) |
| 19:21.09 | connor_ | Anyone here use tmux? |
| 19:21.14 | justin_ | m1ndvirus: oh, no you don't, I see, that's broken |
| 19:21.19 | m1ndvirus | jelly-home: Please forgive me. I have certain concerns that you may not have, so I need to explicitize them. |
| 19:21.30 | justin_ | m1ndvirus: someone added those rules at the end, and they should be before the "RH-Firewall-1-INPUT" |
| 19:21.34 | *** join/#debian zamberlan (~zamberlan@200.241.78.18) |
| 19:21.37 | *** join/#debian ring1 (~ring0@unaffiliated/ring0) |
| 19:21.47 | ConnorVM2 | I'm trying to change the functionality of C-b to C-a like screen, but the keybind change is only functional as root, any ideas? |
| 19:21.50 | stew | RH-Firewall-1-INPUT? this is a redhat/centos/fedora machine? |
| 19:21.53 | jelly-home | m1ndvirus: and yet you're asking for help in a public channel which has rules of its own |
| 19:22.00 | justin_ | if you ran iptables -L -n I bet you'd see that none of those rules are ever getting hit |
| 19:22.06 | m1ndvirus | stew: No. |
| 19:22.13 | *** join/#debian gremset (ubuntu@117.192.123.16) |
| 19:22.19 | m1ndvirus | jelly-home: I apologize. |
| 19:22.23 | justin_ | er, -Lnv |
| 19:22.29 | usr13 | m1ndvirus: Here is what you can do: |
| 19:22.39 | justin_ | or even, -L -nv.. iptables is so picky |
| 19:22.41 | *** join/#debian gremset (ubuntu@117.192.123.16) |
| 19:22.41 | m1ndvirus | http://paste.pocoo.org/show/385979/ |
| 19:23.04 | usr13 | iptables -A INPUT -i eth0 -p tcp -s 192.168.1.9 --dport 2049 -j ACCEPT |
| 19:23.10 | *** join/#debian MikeH_ (~mike@2001:470:1f09:14ed:3058:a330:1cac:4612) |
| 19:23.14 | *** join/#debian dajhorn (~dajhorn@75.17.126.238) |
| 19:23.18 | justin_ | usr13: not going to work |
| 19:23.23 | stew | the INPUT chain already defaults to ACCEPT |
| 19:23.36 | stew | oh, except the RH-Firewall stuff, nm |
| 19:23.37 | justin_ | stew: see the -A INPUT -j RH-Firewall-1-INPUT |
| 19:23.44 | justin_ | stew: yeah, whoever edited that ruleset is an idiot |
| 19:23.44 | usr13 | where 192.168.1.9 is the IP of the client. And eth0 is the NIC that the server is connected on. etc. |
| 19:23.52 | justin_ | everything in INPUT after -A INPUT -j RH-Firewall-1-INPUT is ignored |
| 19:23.54 | usr13 | justin_: Why wouldn't that work? |
| 19:24.01 | stew | "Generated by iptables-save v1.3.3" |
| 19:24.06 | stew | m1ndvirus: what os is this? |
| 19:24.19 | jelly-home | m1ndvirus: note that rules in lines 17-23 are never triggered |
| 19:24.33 | stew | etch had a newer iptables than this |
| 19:24.42 | *** join/#debian gusto (~gusto@p4FFE658B.dip.t-dialin.net) |
| 19:24.56 | jelly-home | I guess his client is Debian ;-) |
| 19:24.59 | usr13 | Ok well never mind. I just blocked and accetpted nfs on my server with that rule but, I guess I don't have the same set of rules on mine, so... |
| 19:25.09 | *** part/#debian centHOGG (~centHOGG@adsl-67-67-223-157.dsl.austtx.swbell.net) |
| 19:25.26 | *** join/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 19:25.28 | *** join/#debian connor_ (~connor@ip72-204-33-197.fv.ks.cox.net) |
| 19:25.33 | *** part/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 19:25.36 | connor_ | Fixed it |
| 19:25.57 | jelly-home | m1ndvirus: that iptables config is a bit of a mess |
| 19:26.06 | simonlnu | hateses iptables |
| 19:26.07 | *** join/#debian dzinx (~dzinx@82-171-32-236.ip.telfort.nl) |
| 19:26.15 | m1ndvirus | It's Dapper. I'm sorry for asking in #debian but I know exactly how much smarter this channel is than #ubuntu. |
| 19:26.22 | simonlnu | ... |
| 19:26.28 | *** join/#debian Gottaname (~Gottaname@bb116-15-183-47.singnet.com.sg) |
| 19:26.54 | usr13 | m1ndvirus: What OS do you have running on the server? |
| 19:27.01 | m1ndvirus | Dapper, once again. |
| 19:27.06 | m1ndvirus | Client's on Lucid. |
| 19:27.20 | *** join/#debian donvito (donvito@c-6a0a72d5.011-314-76786a1.cust.xdata.no) |
| 19:27.29 | jelly-home | m1ndvirus: try ##linux channel or #ubuntu-server |
| 19:27.36 | m1ndvirus | *sigh* |
| 19:28.52 | *** join/#debian citn (~cristian@82-168-167-138.ip.telfort.nl) |
| 19:29.11 | m1ndvirus | If I didn't say I was on Ubuntu you'd have been perfectly happy continuing. :( |
| 19:29.20 | themill | m1ndvirus: we don't know if this is a problem with your iptables, nfs config or even what versions they have. Please ask in the appropriate place. |
| 19:29.28 | usr13 | m1ndvirus: Ubuntu 6.06 ? Dapper? EOF for Dapper was a while ago. You know that, right? |
| 19:29.32 | simonlnu | it was obvious this wasn't a debian box. |
| 19:29.33 | m1ndvirus | I do. |
| 19:29.52 | jelly-home | m1ndvirus: au contraire, you should have stated it right away so we could tell you to ask in a better place |
| 19:29.56 | m1ndvirus | simonlnu: I don't believe you. |
| 19:30.09 | simonlnu | *shrug* |
| 19:30.13 | m1ndvirus | jelly-home: I got a LOT of information out of our exchange. |
| 19:30.22 | m1ndvirus | It's obviously the firewall's fault. |
| 19:30.31 | themill | m1ndvirus: it gets quite boring debugging problems in other distributions when those problems don't exist in debian. |
| 19:30.54 | justin_ | themill: technically the problem is 'dumb firewall admin' and is distro neutral :) |
| 19:31.01 | simonlnu | wastes everyone's time and energy too |
| 19:31.09 | m1ndvirus | simonlnu: Definitely no waste going on. |
| 19:31.11 | stew | lets please just stop |
| 19:31.18 | m1ndvirus | I learned a lot and you have helped me all debug very much. |
| 19:31.30 | *** join/#debian davidisko1 (~davidisko@nat-88-212-37-51.antik.sk) |
| 19:31.47 | usr13 | m1ndvirus: Ubuntu 6.06's support ended on 14 July 2009 You guys should consider upgrade. |
| 19:31.55 | m1ndvirus | We are doing that. |
| 19:32.01 | *** join/#debian SlickT10 (~SlickT10@66.110.220.207) |
| 19:32.04 | stew | usr13, m1ndvirus: please move this to #ubuntu |
| 19:32.04 | m1ndvirus | That is actually the current project I am working on. |
| 19:32.13 | m1ndvirus | Thanks all! |
| 19:32.14 | *** part/#debian m1ndvirus (m1ndvirus@unaffiliated/mindvirus) |
| 19:32.26 | usr13 | m1ndvirus: You can go to 8.04 if you have it set to LTS |
| 19:32.52 | *** part/#debian bronaugh (bronaugh@devel2.pcic.uvic.ca) |
| 19:32.59 | *** join/#debian atan (~atan@unaffiliated/atan) |
| 19:33.30 | *** join/#debian mickeul (~mikady@62.201.142.95) |
| 19:33.36 | *** part/#debian mickeul (~mikady@62.201.142.95) |
| 19:33.41 | simonlnu | he left |
| 19:34.22 | *** join/#debian MarKsaitis (~MarKsaiti@82.144.242.158) |
| 19:35.04 | jelly-home | the m1ndivurs guy's in #netfilter in case anyone wants to continue |
| 19:35.29 | *** join/#debian cdahmede- (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 19:35.51 | *** join/#debian maplebed (~maplebed@c-24-7-114-173.hsd1.ca.comcast.net) |
| 19:36.39 | maplebed | Hi all; I'm building a debian package and i want it to create an empty directory. I have 'install -m0755 -o root -g root -d /path/to/dir' in my makefile, but it's not creating it. |
| 19:36.39 | *** join/#debian warren (~warren@wsip-98-191-125-85.ph.ph.cox.net) |
| 19:36.53 | *** join/#debian rafuch0 (~flux@190.38.228.128) |
| 19:36.54 | maplebed | I noticed the cron package drops a file called '.placeholder' in /etc/cron.*; |
| 19:36.58 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 19:37.00 | maplebed | is that considered the "right way" to do it? |
| 19:37.31 | *** join/#debian gusto (~gusto@p4FFE798F.dip.t-dialin.net) |
| 19:38.47 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 19:38.50 | *** join/#debian jahil1 (~mohsin@94.203.101.202) |
| 19:38.52 | *** join/#debian chaisen (~chaisen@p4FD48884.dip0.t-ipconnect.de) |
| 19:38.55 | maplebed | (sorry, correction, my makefile's target is ${DESTDIR}/path/to/dir) |
| 19:39.03 | warrenchild | Hello all I am installing Debian system, and it fails at software and install. I think it is because of how I have my partitions set up. okay so here it does. I have 4 hard disks, I am setting up Software RAID. I have a RAID 1 1GB partition mounted on /. I have a 3 10GB partitions for SWAP, /tmp, and /var, then I have a 1.1TB partition setup for /home. does anyone know why it is not working? |
| 19:39.33 | warrenchild | the last 4 partitions are set up as RAID 5 |
| 19:39.49 | warrenchild | my 4th disk is the extra disks for the set up |
| 19:40.05 | warrenchild | I have it formated as EXT. 3 |
| 19:40.45 | *** join/#debian methril_work (~Rafael@189.114.111.135) |
| 19:41.01 | *** mode/#debian [+l 1151] by debhelper |
| 19:41.20 | jhutchins | warrenchild: That's a pretty insane partition scheme. |
| 19:41.28 | *** join/#debian arif-ali (~arif-ali@88-111-135-136.dynamic.dsl.as9105.com) |
| 19:41.47 | jhutchins | warrenchild: Have you considered just how log it would take to swap 30GB to and from disk? |
| 19:41.55 | warrenchild | jhutchins: I thought that is how you had to have things set up for RAID 5 because grub will not boot off a RAID 5 |
| 19:42.03 | *** join/#debian f8l (~f8l@81.219.203.149) |
| 19:42.06 | *** join/#debian takamoron (~nearly@c-24-21-223-207.hsd1.or.comcast.net) |
| 19:42.13 | warrenchild | not all 30GB is for swap |
| 19:42.16 | warrenchild | swap has a 10GB |
| 19:42.26 | *** part/#debian xrl (u1091@gateway/web/irccloud.com/x-hkeimihfbzddxjoo) |
| 19:42.33 | jhutchins | Oh, I see, swap, temp, and var. |
| 19:42.38 | warrenchild | yes |
| 19:43.00 | justin_ | warrenchild: are you sure you want to use raid5 and not raid10? |
| 19:43.38 | warrenchild | if I was using RAID10 will grub boot from it? and and make the computer be able to boot in degraded mode say a hard disk failed? |
| 19:44.00 | *** join/#debian EagleScreen (~quassel@90.164.84.116) |
| 19:44.10 | justin_ | easiest thing to do would be to create a tiny raid 1 / with 2 hot spares |
| 19:44.16 | jhutchins | warrenchild: I'm pretty sure grub2 will boot to raid5, and I know lilo will. |
| 19:44.21 | jelly-home | warrenchild: soft raid? I wouldn't use anything but raid1 for /boot partition |
| 19:44.36 | warrenchild | jelly-home yes soft raid |
| 19:44.43 | *** join/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 19:44.58 | warrenchild | so if I mount tne / on the raid one and I do not specify the /boot will it automatically put /boot on raid 1? |
| 19:44.59 | jelly-home | jhutchins: we just has a person here over the weekend whose grub failed to boot raid5 after the array got degraded |
| 19:45.12 | warrenchild | jelly-home |
| 19:45.14 | warrenchild | that was me |
| 19:45.15 | warrenchild | lol |
| 19:45.17 | justin_ | you don't need a /boot partition for raid1 |
| 19:45.22 | jelly-home | warrenchild: oh fuc |
| 19:45.31 | justin_ | just don't use raid5 :) |
| 19:45.45 | *** join/#debian Rand0 (~mvohra@155.229.3.50) |
| 19:45.49 | warrenchild | debian 6.0.1a uses grub 2 so then I will be okay! |
| 19:46.02 | jelly-home | yeah, sure, do what you want <g> |
| 19:46.07 | warrenchild | but that is the way I had it, everything was running from RAID 5, and the computer would not start in degraded mode |
| 19:46.09 | Rand0 | So... one thing I've wondered for a long time: Why does debian install exim4 by default? |
| 19:46.29 | jelly-home | Rand0: it's better than the previous default |
| 19:46.45 | *** join/#debian format_c (~format_c@2001:4dd0:fc0c:0:6e62:6dff:fe4a:e47d) |
| 19:46.45 | jelly-home | which was... what, smail? |
| 19:46.48 | Rand0 | Shouldn't the default mailserver be some sort of queueless sendmail binary? |
| 19:46.57 | jelly-home | Rand0: $DEITY no |
| 19:47.19 | jelly-home | Rand0: I like my unix machines able to deliver to local accounts |
| 19:47.21 | Rand0 | why not? |
| 19:47.24 | Rand0 | yeq |
| 19:47.27 | *** join/#debian takamoron (~nearly@c-24-21-223-207.hsd1.or.comcast.net) |
| 19:47.27 | Rand0 | *yea |
| 19:47.28 | jelly-home | _and_ to remote ones |
| 19:47.39 | Rand0 | but that does not mean that it can't be queueless |
| 19:47.39 | methril_work | hi guys |
| 19:47.49 | *** part/#debian maplebed (~maplebed@c-24-7-114-173.hsd1.ca.comcast.net) |
| 19:47.50 | *** join/#debian linduxed (~linduxed@194.14.0.85) |
| 19:47.52 | methril_work | i would like to know how are you dealing with linaro team |
| 19:47.56 | methril_work | and if i could help |
| 19:47.58 | webad_13 | could someone point me in the right direction for changing the restart options in kernel - I remember you could select different types of options for restart... Right not my laptop does not restart properly (it is more of a hard restart, shutdown/poweron) |
| 19:48.13 | *** join/#debian phantomcircuit (~phantomci@adsl-99-33-24-242.dsl.pltn13.sbcglobal.net) |
| 19:48.14 | jelly-home | Rand0: sure, but do you know of a decent queueless MTA that does both? |
| 19:48.15 | *** join/#debian NeoBlaster (~N3oBl@st3r.net) |
| 19:48.18 | webad_13 | now* |
| 19:48.21 | Rand0 | I'm just not a fan of having a box listen on port 25 by default. |
| 19:48.33 | jelly-home | Rand0: it doesn't do that. |
| 19:48.59 | warrenchild | Jelly-home, if you were going to do a RAID how would you have it setup? |
| 19:49.01 | Rand0 | Especially with bugs like this: http://xorl.wordpress.com/2011/05/06/exim-dkim-signatures-remote-format-string/ |
| 19:49.12 | Rand0 | \No? |
| 19:49.20 | *** join/#debian cafaro_ (~cafaro@unaffiliated/cafaro) |
| 19:49.27 | Rand0 | hmm, I just assumed |
| 19:49.28 | jelly-home | Rand0: no. Have you tried installing Debian from scratch recently? |
| 19:49.36 | Rand0 | yes |
| 19:49.47 | Rand0 | well, recently as in 6 months ago. |
| 19:49.54 | jelly-home | Rand0: and did it set up exim listening on a public ip? |
| 19:49.59 | justin_ | Rand0: the default configuration of exim in debian listens on 127.0.0.1 |
| 19:50.20 | Rand0 | well one of the first things I do after installing is apt-get remove exim4 |
| 19:50.33 | Rand0 | and if I'm running a mailserver, then I apt-get install postfix. |
| 19:50.50 | jelly-home | Rand0: that's the good thing about defaults -- they can be changed |
| 19:50.52 | *** join/#debian SlickT10 (~SlickT10@66.110.220.207) |
| 19:50.54 | Rand0 | yep |
| 19:51.22 | Rand0 | I just thought exim was sort of bloated to do a very simple task |
| 19:52.22 | *** join/#debian greeneg|work (~quassel@67.203.151.50) |
| 19:52.40 | jelly-home | warrenchild: small raid1, metadata 0.9 or 1.0, for /boot, the rest whatever md raid you need it to be, with one hot spare if possible, and probably lvm on top of that |
| 19:53.00 | *** join/#debian talos_ (~talos@ppp046176036194.dsl.hol.gr) |
| 19:53.24 | warrenchild | jelly-home: thanks, so my 1GB is for /boot then I can set the other raid up to mount as / |
| 19:53.33 | warrenchild | is\\\does that sound correct? |
| 19:54.12 | Rand0 | </whining> |
| 19:54.24 | justin_ | warrenchild: not even close |
| 19:54.52 | warrenchild | what are your inputs then justin_ |
| 19:54.59 | justin_ | I told you what to do |
| 19:55.23 | justin_ | make a 5G or so raid1 for / with 2 hot spares, use the rest for a raid10 array |
| 19:55.32 | *** join/#debian Gottaname (~Gottaname@bb116-15-95-18.singnet.com.sg) |
| 19:55.37 | jelly-home | warrenchild: no need to have more than 256MB for /boot |
| 19:55.42 | *** join/#debian jaytaph (~jaytaph@dhcp-077-249-050-185.chello.nl) |
| 19:55.47 | justin_ | no need tohave a /boot in the first place |
| 19:56.09 | jelly-home | it's a decent conservative practice that goes well with lvm |
| 19:56.29 | justin_ | I always just make / 5G or so, and use the rest for lvm |
| 19:56.39 | a111 | Does debian support the p67 chipsets yet? |
| 19:56.44 | justin_ | makes system recovery a hell of a lot easier when you don't need lvm just to get at your root partition |
| 19:56.54 | jelly-home | a111: who knows? Does Linux kernel support them? |
| 19:56.55 | dualcore | what is suhosin |
| 19:57.05 | justin_ | if you're putting more than 5G into / you're probably doing something wrong |
| 19:57.34 | *** join/#debian walterheck (~walterhec@45-165.1-85.cust.bluewin.ch) |
| 19:57.37 | jelly-home | dualcore: /msg dpkg suhosin |
| 19:57.53 | *** part/#debian dawud (~dawud@229.144.217.87.dynamic.jazztel.es) |
| 19:58.05 | *** join/#debian netzsportler (~netzsport@p5DCBF713.dip.t-dialin.net) |
| 19:58.14 | *** join/#debian format_c (~format_c@dslb-188-097-160-014.pools.arcor-ip.net) |
| 19:58.41 | jelly-home | dualcore: hm sorry, dpkg doesn't know about it. Suhosin is a set of patches for PHP meant to make the language more secure in several ways. |
| 19:58.59 | jelly-home | dualcore: http://www.hardened-php.net/suhosin/ |
| 19:59.15 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 19:59.38 | *** join/#debian wissem (~wissem@unaffiliated/wissem) |
| 20:01.16 | *** join/#debian franco (~franco@89.81.118.26) |
| 20:02.33 | *** join/#debian nostriluu (vid@192.219.30.101) |
| 20:03.26 | nostriluu | hi #debian ... i have to recreate a really old (2002 era) mysql/php web site. i would like to track down a 2.1 iso for this purpose, but i can only find a german version. anyone know where i can find an 'english' version ? thanks! |
| 20:04.16 | *** join/#debian freebird_2 (~freebird@189.62.55.25) |
| 20:05.49 | wols_ | english version of what? debian? |
| 20:05.55 | nostriluu | yes |
| 20:06.06 | themill | !cd archive |
| 20:06.06 | dpkg | A repository of older CD images can be found at http://cdimage.debian.org/cdimage/archive/ . Excluding the current <oldstable> release, these are unsupported in #debian. |
| 20:06.19 | wols_ | since when are there "german" versions of debian? |
| 20:06.32 | *** join/#debian cdahmede- (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 20:06.34 | nostriluu | themill thanks, but that only goes back to 3.0 |
| 20:06.51 | nostriluu | wols_ http://mirror.debianforum.de/debian-iso-archive/slink/ |
| 20:06.54 | zorrolero | nostriluu: http://wiki.debian.org/DebianSlink |
| 20:07.37 | Nu^253r | how do i install the package for the kernel source |
| 20:07.39 | wols_ | nostriluu: and what's wrong with this debianforum link? |
| 20:07.45 | Nu^253r | what package shoud i search for? |
| 20:07.47 | nostriluu | zorrolero, that links to the german version |
| 20:08.00 | nostriluu | wols_, it is in german |
| 20:08.04 | wols_ | tho, I think there were 3 or 4 cds. I have at least that many |
| 20:08.28 | wols_ | nostriluu: define "german"? |
| 20:08.38 | nostriluu | wols_, all the interface language is german |
| 20:09.21 | *** join/#debian Speed` (~Curry@cpc1-nfds7-0-0-cust900.8-2.cable.virginmedia.com) |
| 20:09.23 | nostriluu | the first menu is Farbe oder Shcwarz/Weib wählen. |
| 20:09.36 | *** join/#debian moele (~turtle@S010620cf304ce9d6.vs.shawcable.net) |
| 20:09.50 | *** join/#debian DammitJim (~Elive_use@99-75-56-77.lightspeed.dybhfl.sbcglobal.net) |
| 20:10.52 | nostriluu | german ^ like that |
| 20:10.58 | *** join/#debian Alam_Squeeze (~alam@rigginstereo.lawarias.srb2.org) |
| 20:11.38 | *** join/#debian pistolpete (~thomas@p57ACE52C.dip.t-dialin.net) |
| 20:11.41 | *** part/#debian ignotusp (~ignotus@fleshless-dash.volia.net) |
| 20:12.53 | *** join/#debian Old_Spike0 (~Old_Spike@213.37.173.51.dyn.user.ono.com) |
| 20:12.57 | franco | Hi there ! |
| 20:13.19 | *** join/#debian Zekah (~Zekah@2a01:e0b:1:143:62eb:69ff:fe8f:17d6) |
| 20:14.56 | zorrolero | nostriluu: http://www.debian.org/releases/stable/i386/ch05s03.html.en <- 5.3.2 could help you |
| 20:15.48 | jelly-home | nostriluu: schoen |
| 20:15.49 | moele | are there any steam client alternatives for Linux? :) |
| 20:16.08 | nostriluu | zorrolero, thanks trying it |
| 20:16.15 | *** join/#debian omid_ (~omid@94.182.79.162) |
| 20:16.28 | zorrolero | nostriluu: gerne wieder.) |
| 20:16.42 | nostriluu | zorrolero, language=english |
| 20:16.44 | tensorpudding | moele: what would an alternative to steam entail? |
| 20:17.14 | zorrolero | nostriluu: ok, you're welcome! |
| 20:17.23 | wols_ | moele: there cannot be |
| 20:17.43 | tensorpudding | moele: it's not like the games can run on linux anyway |
| 20:18.31 | *** join/#debian linuxwizard (~linuxwiza@c-67-163-41-168.hsd1.il.comcast.net) |
| 20:19.04 | *** join/#debian kalyplato (~kalyplato@cpe-77-83-193-135-dsl.netone.gr) |
| 20:19.04 | *** join/#debian kalyplato (~kalyplato@unaffiliated/kalyplato) |
| 20:19.55 | *** join/#debian jaytaph (~jaytaph@dhcp-077-249-050-185.chello.nl) |
| 20:20.34 | franco | I'm looking for installing ffmpeg with libmp3lame activated. I followed some tutorials, but I'm getting stuck to a point where it seems I'm not alone in this case (can't find any working solutions). I've installed libmp3lame0 from multimedia, and have the sources from ffmpeg, here is the error I have : http://pastebin.com/sJsiMJm7 â Thanks in advance :) |
| 20:21.00 | *** mode/#debian [+l 1145] by debhelper |
| 20:21.20 | *** join/#debian bullgard5 (~detlef@dslb-094-223-014-072.pools.arcor-ip.net) |
| 20:21.34 | phogg | franco: do you have the appropriate -dev package for libmp3lame? |
| 20:21.35 | wols_ | franco: do you have the dev files for libmp3lame installed? |
| 20:21.53 | phogg | heh, same gun |
| 20:22.12 | franco | I do not have the dev package installed, just the libmp3lame0, shoud I install it ? |
| 20:22.22 | phogg | franco: when compiling complains you don't have the library it means "you don't have the headers" which are in the -dev package for the lib. |
| 20:22.27 | franco | (I'm not very good in compiling, never did it by myself) |
| 20:22.29 | wols_ | yes you should. and all the other -dev files ffmpeg needs to compile |
| 20:22.40 | *** join/#debian gnugr (~gnugr@athedsl-214168.home.otenet.gr) |
| 20:22.48 | wols_ | franco: you should not run configure by hand either. you want to create a .deb package instead |
| 20:23.07 | phogg | franco: if you have a deb source for ffmpeg you should do a build-dep for it, even if you won't be installing the package itself. That will get you most things you're likely to need. |
| 20:23.50 | phogg | I should say, if you have an apt source |
| 20:23.55 | *** join/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 20:24.00 | franco | wols_: I just followed some tutorials, they all do it this way, because I need to compile ffmpeg with the libmp3lame option activated, as the ffmpeg package will not include it |
| 20:24.03 | moele | tensorpudding, I know but valve released an official press statement saying they were bringing valve to linux |
| 20:24.08 | moele | tensorpudding, and that was over a year ago |
| 20:24.19 | tensorpudding | it was long, long ago cancelled |
| 20:24.22 | moele | tensorpudding, i fundamentally do not know how it would work, but they did say it is coming. |
| 20:24.49 | moele | tensorpudding: is that conjecture or fact? |
| 20:24.55 | *** join/#debian F66F (~tobias@pD955375B.dip.t-dialin.net) |
| 20:25.03 | phogg | moele: fact |
| 20:25.14 | F66F | hi can some give me a hint to a good motorcycle cannel? |
| 20:25.20 | moele | phogg, can you find me a link saying so? |
| 20:25.27 | tensorpudding | they issued a statement on it like in 2009 |
| 20:25.36 | phogg | moele: I do not have it on me, I read it at the time. The company denied that one was being worked on |
| 20:26.01 | jhutchins | The PDF's that xsane is generating are very large. Is there a tool I can use to compress them better? |
| 20:26.45 | moele | phogg, , I found one |
| 20:26.58 | *** join/#debian phin (phin@fishmn.info) |
| 20:27.00 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 20:27.04 | moele | phogg, turned out the guy who spread the rumour just wanted to gain more traffic to his site, or something on those lines |
| 20:27.23 | moele | phogg, :( oh well |
| 20:27.29 | *** join/#debian WifiBrn2 (brain@cpc2-mapp3-0-0-cust318.12-4.cable.virginmedia.com) |
| 20:27.39 | phogg | moele: there are a lot of jerks in the world. |
| 20:28.01 | *** join/#debian Japeeh (~meh@unaffiliated/burnikki) |
| 20:28.07 | jhutchins | The only option I see in xsane is zlib compression, which is enabled. |
| 20:28.19 | webad_13 | please anyone - I am desperately trying to remember the different reboot options that you can set in grub, but I am unable to find a link or anything about it |
| 20:28.30 | moele | phogg, tell me something, are there any websites that tell which current games have linux support? |
| 20:28.34 | twobitsprite | webad_13: reboot options in grub? |
| 20:28.43 | webad_13 | my laptop does not do a proper reboot so I would like to experiment with different options |
| 20:28.45 | phogg | moele: appdb on winehq is reliable |
| 20:28.57 | phogg | moele: or do you mean native? |
| 20:29.01 | moele | phogg, i was more on the lines of actual native linux binaries, for developers who actually made clients |
| 20:29.06 | moele | phogg, that is precisely what I meant |
| 20:29.07 | twobitsprite | webad_13: what does it do and what were you expecting it to do? |
| 20:29.09 | phogg | moele: for native games I always use happypenguin, though it's cumbersome |
| 20:29.14 | moele | hmm |
| 20:29.18 | moele | im familiar with it |
| 20:29.47 | phogg | moele: using their search you can filter by cost/license, I believe, which will get you commercial games. It's not comprehensive but I know no better list. |
| 20:29.58 | phin | anyone know when gnome3 plans to be packaged for unstable? |
| 20:30.00 | zleslie | What does it mean when its a "transitional package" |
| 20:30.00 | *** join/#debian rgr (~user@85.183.18.158) |
| 20:30.02 | zleslie | ? |
| 20:30.14 | zleslie | is it being deprecated in favor of something else? |
| 20:30.16 | twobitsprite | zleslie: it means they changed package names, or replaced a package with someone else |
| 20:30.20 | franco | phogg, wols_ I thinks it's working, actually I'm making/make install, sorry wols_ but I do not know how to make a deb package (n00b) :P |
| 20:30.20 | phogg | moele: freshmeat might also be an option. I don't know if games are often listed there. |
| 20:30.21 | twobitsprite | zleslie: yep, pretty much |
| 20:30.22 | wols_ | zleslie: yes, usually |
| 20:30.43 | moele | phogg, it's really ironic, I would say the Linux user base is large enough now to justify Software Developers to look for viable alternatives to put into developing games for Linux, if they can do it for MacOSX, why not us :) |
| 20:30.46 | twobitsprite | zleslie: the transitional package is left around to make upgrades go more smoothly |
| 20:30.46 | wols_ | franco: you will get lots of problems with your ffmpeg in the future. |
| 20:30.52 | phogg | franco: if the compilation works you should look in to learning to make debs. It's a little more effort but worthwhile. |
| 20:31.14 | zleslie | so in the case of dhcp3-server, I see nowhere in the info that it says the name of the package that is taking over the function |
| 20:31.19 | *** join/#debian abchirk__ (~abchirk@g225125231.adsl.alicedsl.de) |
| 20:31.23 | wols_ | moele: cause the average OSX users pays more for their software. on linux, everything is free, including many games |
| 20:31.27 | phogg | moele: because the Linux userspace stack as it relates to games is confusing, convoluted, unevenly documented and frustratingly different between distributions. |
| 20:32.07 | twobitsprite | zleslie: well, it depends on and is provided by isc-dhcp-server |
| 20:32.11 | moele | phogg, the underlying mechanisms used to render 3D is the same |
| 20:32.16 | phogg | moele: most developers who are writing for OS X or Windows are used to having their hands held by comprehensive SDKs. |
| 20:32.18 | moele | phogg, we are all using OpenGL on that level |
| 20:32.35 | phogg | s/writing/writing games/ |
| 20:32.46 | *** join/#debian Skaperen (~phil@c-76-125-202-149.hsd1.wv.comcast.net) |
| 20:32.49 | twobitsprite | zleslie: and isc-dhcp-server replaces dhcp3-server |
| 20:33.03 | *** join/#debian itchi (~David@unaffiliated/itchi) |
| 20:33.06 | webad_13 | twobitsprite, u set it in grub so that they are loaded |
| 20:33.06 | webad_13 | but it is the kernel |
| 20:33.06 | webad_13 | twobitsprite: currently my laptop does a "hard reset" where memory is checked like from a shutdown (even led changes color as if it was shut down) |
| 20:33.06 | webad_13 | I remember the once someone advised me to change the reboot options or something like that |
| 20:33.06 | *** kick/#debian [webad_13!~debhelper@unaffiliated/debhelper] by debhelper (use http://paste.debian.net or /msg dpkg paste) |
| 20:33.07 | zleslie | yeah, I see that. Its just not explicit |
| 20:33.18 | zleslie | depends is counter intuitive |
| 20:33.27 | franco | wols_ phogg Sure do I, but I'm using ffmpeg just for a small feature of my website (I'm a web developper) I just need to be up quick... :/ hope it will works for this feature :P |
| 20:33.27 | moele | phogg, I think that is a good point, between distribution and distribution there are too many fundamental differences in release to distribute a universally compatible Binary |
| 20:33.45 | moele | phogg, would be very difficult, if they just choose Ubuntu for instance and released only on that platform that would lessen their burdens |
| 20:33.51 | moele | phogg, but I can certainly see where you are coming from |
| 20:33.57 | phogg | franco: you are always welcome to go it alone and support it yourself |
| 20:33.59 | *** join/#debian larsivi (~quassel@188.113.74.106) |
| 20:34.09 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 20:34.22 | phogg | moele: even that is not a cure for the problem |
| 20:34.24 | simonlnu | !tell webad_13 -about paste |
| 20:34.30 | franco | phogg: I don't get it |
| 20:34.32 | *** join/#debian Tux^verdreifelt (Tux_verdre@piratenpartei/ni/tux) |
| 20:34.35 | moele | phogg, it isnt a cure but it is an alternative |
| 20:34.39 | moele | phogg, and one that would likely work |
| 20:34.45 | wols_ | phogg: if they did, they'd lose all the other distros.... thus there wouldn't be a big enough userbase. surely OSX has more users than ubuntu alone |
| 20:35.02 | webad_13 | simonlnu: what did I paste that kicked me out |
| 20:35.20 | moele | phogg, if you had commercial entities willing to contribute to this type of infrastructure you would likely see a more robust and polished 3D library as well |
| 20:35.26 | phogg | wols_: True. And, also, the fundamental problem is a lack of cohesion. Ubuntu would have to start paying attention to maintaining the platform first. |
| 20:35.28 | webad_13 | in any case it was by mistake if I pasted sth |
| 20:35.32 | simonlnu | webad_13: not "pasting" but you must have lagged out |
| 20:35.49 | simonlnu | webad_13: the bot read it as pasting or multi-line input |
| 20:35.52 | moele | phogg, im just hypothesizing really :0 |
| 20:36.15 | phogg | moele: welcome to the conversation. I was saying much the same thing ten years ago. |
| 20:36.21 | webad_13 | simonlnu: ah yeah could be - my network is really bad here |
| 20:36.32 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 20:36.34 | twobitsprite | webad_13: the memory check is part of your bios |
| 20:36.40 | moele | phogg, 10 years ago I was still using Slackware <sigh> |
| 20:36.45 | moele | phogg, I feel so old now, thanks so muhc |
| 20:36.59 | *** join/#debian MrOpposite (~mropposit@unaffiliated/mropposite) |
| 20:37.15 | phogg | moele: Age brings welcome. Do you now feel wise? You're welcome. |
| 20:37.29 | buhman | I can record sound with my mic just fine after installing gstreamer0.10-gconf. Empathy would appear to crash (at least the ui thread) until after I installed this. So now recording appears to work locally: I can now open the sound recorder and play it back |
| 20:37.47 | buhman | but my friend can't hear what I'm saying on empathy even though the recording volume bar seems to behave properly |
| 20:37.47 | webad_13 | twobitsprite: true but this happens because of imporper reboot. For instance on Windows the led does not change the color when rebooting and there is no memory check. So something is telling my bios that it was comp was shut down and that is why the memory check |
| 20:38.05 | buhman | the google talkplugin seems to crash whenever loaded, so I'm thinking there's still a problem with my configuration |
| 20:38.10 | webad_13 | twobitsprite: btw, there is no option for me in BIOS to disable memory check |
| 20:38.21 | moele | phogg, not particularly :) |
| 20:38.24 | wols_ | webad_13: how are you rebooting in linux? |
| 20:38.33 | *** join/#debian ajikeshi (~ajikeshi@unaffiliated/ajikeshi) |
| 20:38.42 | webad_13 | wols_: you mean the command? sudo reboot.... |
| 20:38.46 | *** join/#debian r3c4ll (~r3c4ll@190.77.235.170) |
| 20:39.03 | moele | phogg, and I'll assume you meant wisdom, as well as dementia and decrepitude :) |
| 20:40.07 | phogg | moele: welcome? wow, my autocorrect is having a field day. Yeah, wisdom. |
| 20:40.11 | jhutchins | Bushmills: What release, what DE? |
| 20:40.18 | jhutchins | Bushmills: Oops. |
| 20:40.27 | twobitsprite | webad_13: might have something to do with acpi |
| 20:40.35 | twobitsprite | webad_13: what kernel options do you have right now? |
| 20:40.58 | Bushmills | jhutchins, stable, testing and unstable. gnome/compiz on testing |
| 20:41.17 | jhutchins | Bushmills: Yeah, there was a bushman having trouble with his mic. |
| 20:41.44 | twobitsprite | jhutchins: you mean buhman |
| 20:41.46 | webad_13 | twobitsprite: acpi_enforce_resources=strict |
| 20:41.50 | *** join/#debian manio (~mariusz@87-206-100-87.dynamic.chello.pl) |
| 20:41.55 | jhutchins | So I do. |
| 20:42.07 | jhutchins | buhman: What release? What desktop? |
| 20:42.56 | *** join/#debian eptalon (~robert@wikipedia/Eptalon) |
| 20:44.23 | buhman | jhutchins: wheezy |
| 20:44.27 | buhman | jhutchins: desktop? |
| 20:44.45 | jhutchins | buhman: Gnome? |
| 20:45.00 | buhman | jhutchins: yes |
| 20:45.20 | jhutchins | buhman: I wonder if it works in squeeze? |
| 20:45.27 | *** join/#debian twinkie_ (~twinkie@adsl-216-78-223-47.sdf.bellsouth.net) |
| 20:45.33 | buhman | jhutchins: I just installed gstreamer0.10-pulseaudio and then the google talk plugin seems to have stopped crashing |
| 20:45.38 | buhman | jhutchins: and it did |
| 20:46.02 | buhman | jhutchins: It seems like I'm incrementally solving the problem by adding missing packages |
| 20:46.17 | *** join/#debian ctrl-z (~oz@144-24.3-85.cust.bluewin.ch) |
| 20:46.48 | DammitJim | how do I update xbmc to 10.1 on squeeze? |
| 20:46.53 | *** join/#debian smica (~smica@109-61-48-99.adsl-pool.dravanet.hu) |
| 20:47.14 | jhutchins | ,versions xmbc |
| 20:47.14 | judd | Sorry, no package named 'xmbc' was found in i386. |
| 20:47.27 | twobitsprite | DammitJim: what is xbmc? |
| 20:47.34 | DammitJim | there is a package through the multimedia repo |
| 20:47.47 | DammitJim | xbmc is like a media center interface... it's quiet nice, actually |
| 20:47.52 | buhman | jhutchins: the mic seems inverted somehow: noise is output, except for when I talk and then the mic meter goes down; when I record locally, however, I hear both the noise and the voice |
| 20:48.02 | warrenchild | XBMC = Xbox Media Center |
| 20:48.09 | twobitsprite | ohh yeah, I remember that |
| 20:48.21 | warrenchild | it is used for the hack of exbox when installing linux onto it |
| 20:48.25 | twobitsprite | DammitJim: is the version you want not in the dmm repo? |
| 20:48.25 | jhutchins | buhman: I'd revert to stable. |
| 20:48.27 | DammitJim | they have fixed many things between 10.5 (which is in the squeeze repo) and 10.1 (which is in the wheezy depo) |
| 20:48.32 | warrenchild | they cannot have it in a repository because it uses microsoft coding |
| 20:48.36 | warrenchild | so you have to compile it yourself |
| 20:49.06 | DammitJim | http://debian-multimedia.org/ |
| 20:49.08 | warrenchild | you can find to source code, there is alos people who compile it and put it on torrents. |
| 20:49.15 | DammitJim | but warrenchild , you are saying I need to compile it from source? |
| 20:49.18 | warrenchild | it dos\es not run verywell on linux though just to let you know very laggy |
| 20:49.31 | warrenchild | dammitjim: yes |
| 20:49.45 | DammitJim | warrenchild, I've used xbmc for years on lenny... w/o many problems |
| 20:50.01 | warrenchild | hmm, well I have a quad core witrh 5 GB ram and it was laggy for me |
| 20:50.07 | jhutchins | DammitJim: That or send something nice to Mr. Marilatt. |
| 20:50.30 | *** join/#debian biscraft (~biscraft@41.226.227.213) |
| 20:50.30 | *** join/#debian biscraft (~biscraft@unaffiliated/biscraft) |
| 20:50.38 | DammitJim | lol @ jhutchins |
| 20:50.45 | DammitJim | so, my options are: compile it from source |
| 20:50.47 | DammitJim | not use it |
| 20:50.50 | DammitJim | and what is my third? |
| 20:51.00 | jhutchins | Bribe the DMM maintainer. |
| 20:51.01 | DammitJim | send something to Mr Marilatt |
| 20:51.01 | warrenchild | or find it compiled allready download using torrent |
| 20:51.03 | DammitJim | what else? |
| 20:51.24 | DammitJim | there is no way I can mix the repo for squeeze with the wheezy one, right? |
| 20:51.32 | twobitsprite | DammitJim: the xbmc website doesn't have binaries, or even debs? |
| 20:51.43 | twobitsprite | DammitJim: not recommended |
| 20:51.43 | *** join/#debian Micki (53192f67@gateway/web/freenode/ip.83.25.47.103) |
| 20:51.44 | jhutchins | DammitJim: Oh, sure, you can do that. Just don't expect to have a stable system. |
| 20:51.56 | *** part/#debian Micki (53192f67@gateway/web/freenode/ip.83.25.47.103) |
| 20:52.01 | *** join/#debian `marianne` (~marianne@cpc1-clif8-2-0-cust963.12-4.cable.virginmedia.com) |
| 20:52.03 | jhutchins | DammitJim: Pretty nearly as hazardous as mixing distributions. |
| 20:52.05 | `marianne` | hiya :) |
| 20:52.10 | DammitJim | no debs, twobitsprite ... they have the source code you can compile... last time I tried doing it, it borked my machine... or I borked it |
| 20:52.33 | DammitJim | ok, then I'll search for a compiled deb in torrents |
| 20:52.35 | warrenchild | the XBMC cannot give it out in repos, or binaries because their code uses microsoft coding so it is illigal to distribute |
| 20:52.35 | jhutchins | DammitJim: Package building is a good skill to learn, but it does take some resources. |
| 20:52.40 | warrenchild | but you can get the source code |
| 20:52.53 | warrenchild | and compile it |
| 20:52.56 | `marianne` | i don't suppose anyone has any experience with installing debian/ubuntu on random ARM devices? |
| 20:53.07 | DammitJim | jhutchins, I now have this itch to try it out again :) |
| 20:53.09 | *** join/#debian webad_13 (~milos@host178-212-static.40-85-b.business.telecomitalia.it) |
| 20:53.17 | DammitJim | random? |
| 20:53.20 | *** join/#debian rafuch0 (~flux@190.38.228.128) |
| 20:54.11 | jhutchins | `marianne`: #debian-arm on irc.oftc.net might. |
| 20:54.21 | `marianne` | random, as in a random chinese netbook that came with android |
| 20:54.35 | `marianne` | thanks, jhutchins, i'll go there and ask :) |
| 20:54.35 | *** join/#debian notrev (~everton@unaffiliated/notrev) |
| 20:54.37 | DammitJim | lol... this sounds fun! |
| 20:54.58 | DammitJim | how can I defragment 1 partition on my laptop? |
| 20:55.02 | DammitJim | it's got jfs |
| 20:55.47 | buhman | is gstreamer-gnomevfs supposed to be installed? |
| 20:56.03 | wols_ | DammitJim: why didn't you google it? |
| 20:56.14 | jhutchins | DammitJim: Generally *nix filesystems don't need defragmenting. |
| 20:56.19 | DammitJim | I did, but there wasn't much that was refering to Debian |
| 20:56.54 | wols_ | "Basically, this script copies the data off the JFS file system to a backup drive, formats the original JFS file system and finally writes back the data from the backup to the freshly formatted drive in a way that JFS will write its allocation trees in a defragmentated way. " |
| 20:57.03 | DammitJim | jhutchins, that's what I thought... but lately my laptop is hella slow |
| 20:57.05 | wols_ | your problem isn't exactly debian specific, is it? |
| 20:57.13 | *** part/#debian citn (~cristian@82-168-167-138.ip.telfort.nl) |
| 20:57.18 | wols_ | DammitJim: how full is your jfs partition? |
| 20:57.20 | *** join/#debian lapsusbrutus (~ah@158.254.202.84.customer.cdi.no) |
| 20:57.27 | *** join/#debian ZykoticK9 (~zykotick9@66.11.174.71) |
| 20:57.38 | DammitJim | wols_, I saw a similar post, but does that mean I need to take the hard drive out of my laptop? |
| 20:57.39 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 20:57.49 | DammitJim | the root partition is about 90% full |
| 20:57.51 | buhman | DammitJim: https://wiki.archlinux.org/index.php/JFS_Filesystem#Defragmenting_JFS looks ok |
| 20:57.58 | wols_ | no it doesn't mean that. it means you need another harddrive which is as big as your jfs partition :( |
| 20:58.06 | buhman | DammitJim: you probably want to use a less-terrible filesystem while you're at it |
| 20:58.24 | DammitJim | buhman, thanks for your input... what should I use instead? |
| 20:58.26 | wols_ | DammitJim: why jfs btw? |
| 20:58.38 | wols_ | DammitJim: if you have to ask, you should use ext3 |
| 20:58.48 | DammitJim | wols_, but it says it's going to format the original partition |
| 20:58.58 | DammitJim | then ext3 is what I will use |
| 20:59.05 | wols_ | yes it is. there is no premade defrag prgroam for jfs |
| 20:59.22 | DammitJim | wols_, then how can I let a script format my partition where root is? |
| 20:59.54 | warrenchild | dammitjim, back up all your important information and reinstall fresh using a better partition table! |
| 21:00.07 | wols_ | you can't :). well, not as long as it's /. you boot another linux (from usb, optical drive, etc) |
| 21:00.10 | nsadmin | wols_: it's useful to remember that as a helper any response that starts with "if you have to ask" assumes that what's on the other end is this rock that doesn't learn ever |
| 21:00.35 | DammitJim | thank you |
| 21:00.45 | *** join/#debian paq (~paq@d24-36-11-96.home1.cgocable.net) |
| 21:00.55 | paq | isn't it about time FF was updated? |
| 21:01.00 | *** mode/#debian [+l 1136] by debhelper |
| 21:01.05 | paq | hi |
| 21:01.08 | wols_ | nsadmin: you are mistaken. have a nice day |
| 21:01.12 | *** join/#debian trumpets9000 (~sgoodpast@72.49.236.38) |
| 21:01.18 | wols_ | paq: updated where? |
| 21:01.24 | *** join/#debian MarKsaitis (~MarKsaiti@82.144.242.158) |
| 21:01.49 | paq | wols_, well, I have stable debian, and FF, and it doesn't support <header> tag, while chrome and opera do |
| 21:01.51 | DammitJim | and I picked originally jfs because someone suggested it's good for large files (I have many videos) to minimize CPU usage |
| 21:02.07 | *** join/#debian molitor (~jamie@host86-154-87-176.range86-154.btcentralplus.com) |
| 21:02.15 | *** join/#debian BrixSat (bc532b6f@gateway/web/freenode/ip.188.83.43.111) |
| 21:02.15 | wols_ | paq: it can't. it's stable. stable doesn't get version updates cause it's stable /msg dpkg stable |
| 21:02.18 | *** join/#debian y3llow_ (~y3llow@111-240-165-191.dynamic.hinet.net) |
| 21:02.19 | BrixSat | hello |
| 21:02.32 | *** part/#debian eptalon (~robert@wikipedia/Eptalon) |
| 21:02.33 | nsadmin | so you don't assume that people can't learn after making such a statement? or if you're correct, is it instead that you;re not willing to support in learning? |
| 21:02.38 | BrixSat | i need some help, i have a server with lamp, and i have defined 3 users each one has its site on their public_html but apache keeps geting 403 :S what permissions should the folder have and apache group should have the user in it? |
| 21:02.43 | *** join/#debian rush2end_ (~rush2end@111-240-165-191.dynamic.hinet.net) |
| 21:03.03 | jhutchins | nsadmin: I knidof have to agree with "if you have to ask you should use ext3". |
| 21:03.29 | paq | wols_, well, that is too bad for me, cause I can't get my web page to work with both chrome and FF then |
| 21:03.29 | warrenchild | nsadmin: I second that |
| 21:03.31 | DammitJim | man, I've never seen such a beautiful tree by using tree -d |
| 21:04.03 | jhutchins | nsadmin: On the principle that it's better to start with defaults and learn what the various options can do than to start with an esoteric option and try to figure out why it doesn't work. |
| 21:04.11 | nsadmin | jhutchins, I'm not agreeing or really disagreeing with that, my comment is relative to what you assume about the person you're trying to help |
| 21:04.14 | paq | wols_, if I change <header> to <div id='myHeader'> it doesn't work in chrome for some reason, which it should |
| 21:04.42 | wols_ | paq: if your webpage breaks cause it doesn't work in ff 3.5, then your html is broken. there are many browsers out there which are worse than ff 3.5 in features. you exclude all of them then |
| 21:04.56 | twobitsprite | nsadmin: well... explaining the differences, pros and cons with all the filesystems it kind of outside the scope of #debian... |
| 21:05.18 | paq | wols_, hmm, I only test for chrome, FF, and IE 8, and opera |
| 21:05.18 | twobitsprite | nsadmin: and, unless you have a very specific performance/reliability profile, then ext3 is fine. |
| 21:05.27 | *** join/#debian manio (~mariusz@87-206-100-87.dynamic.chello.pl) |
| 21:05.27 | jhutchins | Interesting that kde's run dialog is case-insensitive. |
| 21:05.30 | paq | wols_, Can I should the code, it is very short |
| 21:05.36 | nsadmin | there is a piece missing from the statement that is implied, "if you have to ask then you're stupid, I'm not willing to help that and you should use extN" |
| 21:05.39 | paq | wols_, see nadeemelahi@info |
| 21:05.40 | wols_ | !paste |
| 21:05.40 | dpkg | Do not paste more than 2 lines to this channel. Instead, use: http://paste.debian.net/ http://pastie.org/ http://pastebin.com/ http://pastebin.ca/ or http://picpaste.com/ for pics. Use wikisend.com for large files (think tar.gz) up to 100MB. Remember to tell us the URL of your paste! Cannot cut and paste? Ask me about <pastebinit>, <paste2pastebin.pl>, <wgetpaste>. |
| 21:06.03 | wols_ | paq: howeverm this is not #html, so it would be a bit OT. |
| 21:06.09 | abrotman | perhapshe should ask #web |
| 21:06.12 | themill | nsadmin: time to move on... |
| 21:06.22 | DammitJim | it's ok nsadmin... I know the comment is somewhat derrogatory, but that's how they communicate in this channel... I'm used to it.. it's like a tough love |
| 21:06.24 | paq | those css people banned me |
| 21:06.39 | *** join/#debian Apeiron` (~Apeiron@dflo-66-243-230-107.gtcom.net) |
| 21:07.07 | abrotman | so how is this a Debian problem ? |
| 21:07.21 | nsadmin | and that's false. the truth is the other filesystems have their use, and you can either say "if you have to ask ..." or you can be of actual service |
| 21:07.29 | wols_ | abrotman: we're here and read about it. that makes it our problem. isn't this how it always works? |
| 21:07.30 | *** join/#debian Cromulent (~Cromulent@cpc8-reig4-2-0-cust24.6-3.cable.virginmedia.com) |
| 21:07.47 | abrotman | paq: there is #web and #html .. both may be of some help |
| 21:08.22 | *** join/#debian TrueDD (~truedd@unaffiliated/truedd) |
| 21:08.23 | paq | abrotman, #html is quite, and #web requires registration, but I registered on another computer, and so when I try to register again it says I have too many accounts |
| 21:08.38 | twobitsprite | nsadmin: I don't think any here said they don't have their use... but for most applications, ext3 is just fine. And if you have specific requirements for performance/etc, then you already know enough to know what you need, and wouldn't have to ask |
| 21:08.39 | abrotman | use the same registration on the computer you're using? |
| 21:09.03 | wols_ | paq: registering has nothing to do with "other computers". you can log in with your registered username from everywhere. all you need is your password |
| 21:09.17 | nsadmin | #html more for html and css would be off topic there (likely) and #web is about web apps |
| 21:09.24 | TrueDD | Hi all |
| 21:09.37 | abrotman | i doubt the html people would toss him .. |
| 21:09.40 | *** join/#debian negge (~sam@cs109108025015.pp.htv.fi) |
| 21:09.43 | twobitsprite | nsadmin: if the question was "which filesystem has the best performance for small, intemental appends to large files" then the person at least knows what they need... |
| 21:10.00 | twobitsprite | incremental* |
| 21:10.07 | nsadmin | twobitsprite, that's exactly the form that I claim is not serving |
| 21:10.08 | paq | wols_, thing is it says I cannot change nick while banned on channel |
| 21:10.39 | *** join/#debian Worf (~worf@88-117-40-13.adsl.highway.telekom.at) |
| 21:10.45 | wols_ | paq: disconnect from freenode servers and reconnect with your new, registered nick already set |
| 21:10.58 | paq | THose css people went ballistic on me, cause I mentioned about setting margins and padding to 0 using * and setting display block for all using *, and they went nuts. I simply read it in a book |
| 21:11.02 | *** part/#debian nostriluu (vid@192.219.30.101) |
| 21:11.04 | wols_ | paq: howeverm do not try to enter the channel you're banned in, that would be ban evasion which is bad |
| 21:11.08 | nsadmin | or just leave the channel(s) |
| 21:11.36 | twobitsprite | nsadmin: well.. if the person doesn't know what they need in a filesystem, then it's unlikely they're running a server which needs such specific filesystem features, and ext3 will be fine |
| 21:11.41 | paq | I think they are racist in CSS |
| 21:12.01 | paq | Microsoft croonies. There's lots of them. THey are in here too sometimes |
| 21:12.02 | franco | wols_: I finally did the deb package, just sayin ;) thanks for the help anyways |
| 21:12.02 | wols_ | paq: do you have a debian related problem? if not, please stop. thank you |
| 21:12.11 | abrotman | paq: DO you have a Debian question ? |
| 21:12.12 | themill | paq: this still isn't anything to do with #debian. Perhaps #defocus might care. |
| 21:12.15 | nsadmin | twobitsprite, in that case it's most appropriate to ask for xlarification |
| 21:12.23 | wols_ | franco: good job :) don't you feel all fuzzy inside now? |
| 21:12.53 | franco | wols_: ohhh yeah, but I don't know if I could do it again, but it's kind of exciting :) |
| 21:12.56 | *** join/#debian okapi (~okapi@ool-ad0362c3.dyn.optonline.net) |
| 21:12.58 | DammitJim | !dpkg file system |
| 21:13.15 | paq | My desktop loads cairo-dock twice on startup. I can not figure out where it is set twice to remove it once |
| 21:13.16 | DammitJim | what the heck is dpkg doing right now? |
| 21:13.19 | wols_ | DammitJim: no "dpkg" in there. if it has that factoid at all. try /msg dpkg <factoid you want> first |
| 21:13.22 | paq | I am running xfce |
| 21:13.35 | *** join/#debian MarKsaitis_ (~MarKsaiti@82.144.242.158) |
| 21:13.57 | twobitsprite | DammitJim: and "file" is a specific command for dpkg which searchs packages for a given file |
| 21:14.10 | paq | Everytime I log in, I have to quite one instance of cairo |
| 21:14.13 | DammitJim | oh, cool! thanks twobitsprite |
| 21:14.27 | twobitsprite | !filesystem |
| 21:14.27 | dpkg | Journaling filesystems in a nutshell: <peterS> fast but dangerous: reiserfs. medium-speed but reliable: ext3. fast, mostly reliable, and *huge*: xfs. slow, probably reliable: jfs. unknown, probably buggy: reiser4. If you have to ask, use <ext3>. Old benchmarks at http://fsbench.netnation.com/ . http://wiki.debian.org/FileSystem #linuxfs on irc.oftc.net. |
| 21:16.25 | *** join/#debian Alam_Squeeze (quasselcor@rigginstereo.lawarias.srb2.org) |
| 21:16.25 | DammitJim | yeah, I knew it had been said somewhere... If you have to ask, use <ext3>. |
| 21:16.46 | *** join/#debian Mr-R (~rex@p5DCC1262.dip0.t-ipconnect.de) |
| 21:16.51 | wols_ | DammitJim: "if you have to ask" is used often around here. e.g. when people want to run testing or sid and don't know how to get it |
| 21:17.04 | *** join/#debian cdahmede- (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 21:17.35 | *** join/#debian Andorin (~anon@unaffiliated/andorin) |
| 21:17.44 | foetus | ext3 for internal and external hd, small inode size (128) or default (256) with tea hash; xfs for stick, defaults. |
| 21:17.54 | *** join/#debian ICEBreakPoint (~d3mux32@89.181.147.126) |
| 21:17.59 | foetus | boom. |
| 21:18.57 | *** join/#debian tp43_ (~paq@d24-36-11-96.home1.cgocable.net) |
| 21:19.13 | *** join/#debian Creak (~creak@2a01:e35:2f08:750:22cf:30ff:fe8a:eb4a) |
| 21:19.19 | tp43_ | Hi, FYI I was formally known as paq |
| 21:20.01 | franco | wols_: D**n, i'm still getting an error after doing what I need... Does this message mean something to anyone ? http://pastebin.com/b5Dvj45f |
| 21:21.00 | *** mode/#debian [+l 1124] by debhelper |
| 21:21.19 | franco | What codec is he looking for ? :/ |
| 21:21.32 | *** join/#debian rgr (~user@85.183.18.158) |
| 21:21.41 | *** join/#debian ring2 (~ring0@unaffiliated/ring0) |
| 21:22.30 | nsadmin | it said codec parameters not found, so maybe it's asking for you to specify the codec on the command line |
| 21:22.49 | rgr | whats causing this brand new squeeze install to replace my /etc/hosts file each time it restarts? |
| 21:22.52 | *** part/#debian Creak (~creak@2a01:e35:2f08:750:22cf:30ff:fe8a:eb4a) |
| 21:23.12 | abrotman | rgr: resolvconf |
| 21:23.49 | *** join/#debian Kazen (~Kazen@541F86A1.cm-5-8c.dynamic.ziggo.nl) |
| 21:23.53 | rgr | what do I need to do to stop it happening. Doesn't happen on older installs I have for servers. |
| 21:24.06 | abrotman | !tell rgr about fixresolvconf |
| 21:24.12 | jhutchins_lt | rgr: Are you running dhcp? |
| 21:24.30 | rgr | no |
| 21:24.33 | nsadmin | are you using /etc/network/interfaces to specify your connection? |
| 21:24.35 | rgr | abrotman: thanks |
| 21:24.35 | tp43_ | wols_, you there, you think you could join me in #css or #web please |
| 21:24.47 | *** join/#debian ggpigg (~bruce@128.103.9.121) |
| 21:24.48 | *** join/#debian karl (~kpkarl@unaffiliated/karl) |
| 21:25.05 | franco | nsadmin: This is the command working on a local machine (osx), the command line could be different on debian ? |
| 21:25.18 | franco | (I guess it's the same package, ins'nt it ?) |
| 21:25.36 | jhutchins_lt | franco: Yes, it could be different. |
| 21:25.40 | nsadmin | may or may not be |
| 21:26.32 | *** join/#debian Tom012 (~Tom@p5DDFF389.dip.t-dialin.net) |
| 21:26.39 | jhutchins_lt | franco: ffmpeg can be compiled with different libraries and different options. |
| 21:26.58 | jhutchins_lt | franco: Which repository did you get it from on Debian? |
| 21:27.12 | franco | lenny multimedia |
| 21:27.24 | *** part/#debian jaytaph (~jaytaph@dhcp-077-249-050-185.chello.nl) |
| 21:27.33 | jhutchins_lt | franco: Hm, that should handle mp4... |
| 21:27.42 | franco | http://www.balluche.fr/?1090/ffmpeg-Convertir-une-majorite-de-formats-video-et-audio-sous-Linux this is where I got the tutorial (in french) |
| 21:27.42 | *** join/#debian Brigo (~Brigo@139.182.60.213.dynamic.mundo-r.com) |
| 21:28.11 | *** join/#debian pyrony (~epic@office1.klout.com) |
| 21:28.48 | *** join/#debian ilab (ilab@ancient.webfoundation.net) |
| 21:28.52 | *** join/#debian CyrusB (~cyrusb@cmr-208-124-165-82.cr.net.cable.rogers.com) |
| 21:28.55 | *** join/#debian ymasory (~ymasory@c-76-99-55-224.hsd1.pa.comcast.net) |
| 21:28.58 | rgr | should network-admin not update dhclient.conf? |
| 21:29.04 | nsadmin | if it's osx, the messages may or may not be interpretable by people here. supporting it anywhere would require knowledge of how it was compiled... rather than exploring that here, why not run the same thing on debian and from a debian package |
| 21:29.04 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 21:29.13 | jhutchins_lt | !codecs |
| 21:29.13 | dpkg | A codec (portmanteau of "compressor-decompressor") is a program or device used to encode/decode a data stream or signal. Ask me about <libavcodec>, <w32codecs>. |
| 21:29.41 | jhutchins_lt | franco: /msg dpkg w32codecs |
| 21:29.46 | *** join/#debian alpharesearch (~markus@24-158-188-124.dhcp.jcsn.tn.charter.com) |
| 21:29.48 | *** join/#debian babilen (~babilen@unaffiliated/babilen) |
| 21:31.17 | rgr | and I dont have resolvconf installed |
| 21:31.21 | *** join/#debian ymasory (~ymasory@c-76-99-55-224.hsd1.pa.comcast.net) |
| 21:31.33 | nsadmin | then it's your dh client |
| 21:32.02 | franco | nsadmin : I just develop the sites and make it working on OSX, but it's destinated to work on debian. Now I'm having issues with ffmpeg for executing that (and only that one) command. What I just did is compiling it on debian. |
| 21:32.02 | themill | rgr: replacing /etc/hosts? I've never seen that |
| 21:32.42 | *** join/#debian walterheck (~walterhec@132-31.3-85.cust.bluewin.ch) |
| 21:32.42 | jhutchins_lt | franco: Are you certain the mp4 file is valid/intact? |
| 21:32.47 | *** join/#debian karl (~karl@unaffiliated/karl) |
| 21:33.05 | rgr | themill: well, google shows people having the issue in the past. I cant remember doing anything to stop it on other installs. |
| 21:33.08 | franco | jhutchins_lt: thanks, should I check for gstreamer0.10-ffmpeg ? Is that what you wanted to show me ? |
| 21:33.29 | themill | rgr: are you sure you mean /etc/hosts and not /etc/resolv.conf? |
| 21:33.36 | rgr | quite sure |
| 21:33.38 | jhutchins_lt | franco: No, I was pointing you to the w32codecs |
| 21:34.02 | themill | rgr: the netbase postinst is the only thing I know of that changes that file, and it only adds ipv6 data to the bottom of it |
| 21:34.12 | *** join/#debian muneeb (~muneeb@123.237.70.69) |
| 21:34.13 | franco | jhutchins_lt: Yes the mp4 file seems to be intact. |
| 21:34.32 | *** join/#debian R430R (angel@188.214.222.57) |
| 21:34.33 | rgr | well, its getting completely reset and removing all my additional hosts at restart |
| 21:34.48 | rgr | absolutely brand new install of squeeze |
| 21:35.39 | *** join/#debian drew987 (~drew987@ovh.frag.co.uk) |
| 21:35.52 | themill | weird |
| 21:35.57 | rgr | yes. |
| 21:37.13 | rgr | and the dhclient.conf file is identical to the one on my web server and that doesnt wipe the hosts file at restart so I dont think its that. |
| 21:37.25 | foetus | did a ls * to / lol.. |
| 21:38.11 | foetus | lost balance |
| 21:38.15 | *** join/#debian Lesterwood (~gfdsg@c-68-40-197-123.hsd1.mi.comcast.net) |
| 21:38.22 | *** join/#debian elkclone (~patrick@shellium/member/elkclone) |
| 21:39.49 | rgr | hmm, and apache doesnt work out of the box : Python version mismatch, expected '2.6.5', found '2.6.6'. bah. |
| 21:40.17 | jhutchins_lt | rgr: I begin to suspect your sources.list |
| 21:41.58 | *** part/#debian CyberGabber (~CyberGabb@31-183-ftth.onsbrabantnet.nl) |
| 21:42.03 | *** join/#debian rwe45 (~tyuy8o@110.138.178.186) |
| 21:42.04 | rwe45 | [*| NOTICE |*] STARTING JUNE 1ST FREENODE WILL CHANGE THE WAY YOU CONNECT TO IT. UNLESS YOU ENABLE SASL YOU WILL BE UNABLE TO CONNECT TO FREENODE. PLEASE JOIN #FREENODE OR MSG A STAFFER FOR DETAILS [*| NOTICE |*] rwe45 elkclone Lesterwood drew987 R430R muneeb karl ymasory babilen alpharesearch afiestas CyrusB ilab pyrony Brigo ggpigg Kazen ring2 ICEBreakPoint Andorin cdahmede- Mr-R Alam_Squeeze okapi Worf negge TrueDD Cromulent Apeiron` manio |
| 21:42.04 | rwe45 | [*| NOTICE |*] STARTING JUNE 1ST FREENODE WILL CHANGE THE WAY YOU CONNECT TO IT. UNLESS YOU ENABLE SASL YOU WILL BE UNABLE TO CONNECT TO FREENODE. PLEASE JOIN #FREENODE OR MSG A STAFFER FOR DETAILS [*| NOTICE |*] moele Speed` franco format_c netzsportler Gottaname greeneg|work SlickT10 NeoBlaster phantomcircuit linduxed takamoron Rand0 arif-ali methril_work chaisen warrenchild atan davidisko1 donvito dzinx MikeH_ gremset mshindo Ramblurr lanth |
| 21:42.04 | rwe45 | [*| NOTICE |*] STARTING JUNE 1ST FREENODE WILL CHANGE THE WAY YOU CONNECT TO IT. UNLESS YOU ENABLE SASL YOU WILL BE UNABLE TO CONNECT TO FREENODE. PLEASE JOIN #FREENODE OR MSG A STAFFER FOR DETAILS [*| NOTICE |*] BladeFreak DaZ sacredchao dArK_IcE Ricardo__ extor themill brandonw Tigger__ cataliyst poncha|laptop dtcrshr nvz miguetan cornair XSoul TheWarden tensorpudding {41444d494e} trbs tblamer kenjy thiagoss LegolasV sh_sh_ exekias muenchhau |
| 21:42.27 | foetus | sweet. |
| 21:42.40 | Andorin | Cool story bro |
| 21:42.51 | nsadmin | rgr, you're seeing two packages that can be used together but are not otherwise connected. apache works just fine without python |
| 21:43.30 | *** join/#debian dufyhn (~rt6765@95-178-134-181.dsl.optinet.hr) |
| 21:43.31 | dufyhn | [*| NOTICE |*] STARTING JUNE 1ST FREENODE WILL CHANGE THE WAY YOU CONNECT TO IT. UNLESS YOU ENABLE SASL YOU WILL BE UNABLE TO CONNECT TO FREENODE. PLEASE JOIN #FREENODE OR MSG A STAFFER FOR DETAILS [*| NOTICE |*] dufyhn elkclone Lesterwood drew987 R430R muneeb karl ymasory babilen alpharesearch afiestas CyrusB ilab pyrony Brigo ggpigg Kazen ring2 ICEBreakPoint Andorin cdahmede- Mr-R Alam_Squeeze okapi Worf negge TrueDD Cromulent |
| 21:43.42 | *** mode/#debian [+o niko] by ChanServ |
| 21:43.52 | *** mode/#debian [+q $~a] by niko |
| 21:43.52 | Fleetfox | OMG |
| 21:43.52 | jhutchins_lt | Server reop? |
| 21:43.53 | *** mode/#debian [-o niko] by ChanServ |
| 21:43.59 | simonlnu | thank you niko |
| 21:44.03 | kipmacy | i guess that'll cut down on all the annoying people on freenode! |
| 21:44.07 | NeoBlaster | thx :) |
| 21:44.10 | kipmacy | since they won't be able to connect |
| 21:44.11 | dudz_ | hmm |
| 21:44.39 | karl | jhutchins_lt: no, that was a quiet/mute on any non-registered users |
| 21:44.51 | greeneg|work | dufyhn's been spamming a number of channels with the same crap |
| 21:45.06 | jhutchins_lt | greeneg|work: Yeah, it goes around every week or so. |
| 21:45.07 | *** join/#debian Texou (~Texou@unaffiliated/texou) |
| 21:45.08 | dudz_ | do you reckon he's asian ? |
| 21:45.22 | nsadmin | "annoying" and "registered" are independent... we merely wish that weren't true... |
| 21:45.29 | greeneg|work | already have him banned over on the KDE channels |
| 21:45.33 | dudz_ | or maybe american, theres alot of werdos there |
| 21:45.48 | babilen | please take it to ##comment-on-spam :) |
| 21:45.54 | dudz_ | hehe |
| 21:46.01 | babilen | (seriously) |
| 21:46.07 | dudz_ | oki :) |
| 21:46.10 | *** join/#debian headyadmin (~headyadmi@gateway.mirada.com) |
| 21:46.16 | nsadmin | dudz_, maybe he's even racist or racially sensitive... |
| 21:46.29 | *** join/#debian Drew (~drew@rrcs-67-78-3-246.se.biz.rr.com) |
| 21:46.49 | streuner | trolls are racists, they want only attention... |
| 21:46.56 | streuner | s/are/arent/ |
| 21:46.57 | dudz_ | yeah, |
| 21:47.05 | *** join/#debian fredden (~dan@unaffiliated/fredden) |
| 21:47.12 | dudz_ | nothing to do with being racist |
| 21:47.30 | dudz_ | i just picture some crazy little asian kid when i saw that, |
| 21:47.30 | *** join/#debian salvin (~salvin@unaffiliated/salvin) |
| 21:47.36 | dudz_ | either that or some gun nut american |
| 21:47.46 | dudz_ | like with drool coming out of his mouth and laughing histerically |
| 21:47.47 | dudz_ | haha |
| 21:48.12 | nsadmin | notes in passing that dudz_ is apparantly racially sensitive, or assumes location or rase-based connections where there aren't any |
| 21:48.31 | greeneg|work | more likely an infected Windows computer with spyware from a script kiddy |
| 21:48.42 | zumbi | Is the notice an HOAX? |
| 21:48.51 | greeneg|work | far as I know, yes |
| 21:49.03 | themill | zumbi: do freenode staff normally spam channels like that to contact you? |
| 21:49.27 | zumbi | themill: no (thanks) - they almost got me |
| 21:49.32 | babilen | To make this clear: The message is *spam* and commenting on spam is not on-topic here (there is ##comment-on-spam) -- Please take it there or to #debian-offtopic. Thank you! |
| 21:49.35 | dudz_ | nsadmin, everyones entitled to there opinion, you can't say i am wrong when or is there some test to prove i am ? |
| 21:50.26 | dudz_ | i am politically wrong i know, but politics is only a phaze that i think people will grow out of in time. |
| 21:50.44 | dudz_ | anywho, don't mind me |
| 21:50.44 | themill | dudz_, nsadmin: take it to a private message please |
| 21:50.53 | dudz_ | no its cool i'm done |
| 21:52.24 | nsadmin | same here... |
| 21:52.47 | kipmacy | is there a channel about #debian |
| 21:52.59 | *** join/#debian Bar_ (~Bar@85.64.236.16.dynamic.barak-online.net) |
| 21:53.04 | streuner | kipmacy: thats a joke? |
| 21:53.19 | streuner | (or rhetoric question) |
| 21:53.36 | poncha|laptop | kipmacy: try #debian ;-) |
| 21:54.44 | *** part/#debian tDucka (~t3a@ip68-13-62-131.om.om.cox.net) |
| 21:54.56 | *** join/#debian miguetan (~miguetan@237.242.165.83.dynamic.mundo-r.com) |
| 21:55.04 | *** join/#debian t3a (~t3a@ip68-13-62-131.om.om.cox.net) |
| 21:56.01 | *** join/#debian pierrep (~pierrep@65.94.47.151) |
| 21:56.20 | *** join/#debian zerodeux (~zerodeux@bearstech/zerodeux) |
| 21:56.28 | *** join/#debian wissem (~wissem@unaffiliated/wissem) |
| 21:58.37 | *** join/#debian eliasson (~wizard@91.198.48.20) |
| 21:59.35 | *** join/#debian katsrc (~quassel@cpe-69-203-198-189.nyc.res.rr.com) |
| 21:59.36 | *** join/#debian Gugu (~princess@APuteaux-651-1-103-110.w82-124.abo.wanadoo.fr) |
| 22:01.00 | *** mode/#debian [+l 1116] by debhelper |
| 22:01.33 | *** join/#debian simonlnu (simon@unaffiliated/simonrvn) |
| 22:02.13 | *** join/#debian Agiofws (~Agiofws@athedsl-429589.home.otenet.gr) |
| 22:02.16 | streuner | simonlnu: cat /proc/version |
| 22:03.46 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 22:04.22 | *** join/#debian ompaul (~ompaul@unaffiliated/ompaul) |
| 22:05.41 | *** join/#debian tgies (~tgies@wopr.omaha.tgies.net) |
| 22:05.44 | project2501a | shit. i am trying to mount an nfs server from remote and i am getting the following error: "nfs server x.x.x.x not responding mount i/o error" |
| 22:05.54 | project2501a | let's see what google says |
| 22:05.58 | *** join/#debian jrib (~jrib@upstream/dev/jrib) |
| 22:06.05 | *** join/#debian Bartzy (~Bar@85.64.236.16.dynamic.barak-online.net) |
| 22:06.13 | *** join/#debian Maarten_ (~dutchusa@99-73-209-18.lightspeed.irvnca.sbcglobal.net) |
| 22:07.07 | *** join/#debian edward (~edward@4angle.com) |
| 22:07.19 | streuner | project2501a: and please ask in ONE channel :-) |
| 22:07.22 | simonlnu | streuner: what? |
| 22:07.38 | project2501a | streuner: yeah, sorry, man i am a bit stressed :( |
| 22:07.41 | *** join/#debian MadViking (~user@dsl-roibrasgw1-fe8efb00-63.dhcp.inet.fi) |
| 22:07.47 | streuner | simonlnu: * simonlnu hat die Verbindung getrennt (Quit: bbiab, kernel and systemd) |
| 22:07.54 | *** join/#debian vader-- (vader@c-68-83-57-218.hsd1.nj.comcast.net) |
| 22:08.02 | simonlnu | 2.6.38.5-acahkos |
| 22:08.19 | streuner | well, 2.6.38-5 is in sid |
| 22:08.22 | *** join/#debian chemist (chemist@78.33.177.154) |
| 22:08.32 | *** join/#debian oobe (~thingo@unaffiliated/oobe) |
| 22:08.35 | streuner | project2501a: usually no maint answer your questions... |
| 22:08.59 | streuner | project2501a: only when they important and/or you file a bug |
| 22:09.22 | *** join/#debian Malmis (malmis@c83-253-12-116.bredband.comhem.se) |
| 22:09.39 | *** join/#debian engla (~ulrik@wikipedia/Sverdrup) |
| 22:09.39 | *** join/#debian jernux (~chatzilla@pool-71-105-117-41.lsanca.dsl-w.verizon.net) |
| 22:09.45 | *** join/#debian Kevin` (~kevin@nelson.kwzs.be) |
| 22:10.24 | *** part/#debian jernux (~chatzilla@pool-71-105-117-41.lsanca.dsl-w.verizon.net) |
| 22:10.44 | engla | My desktop installation of debian testing does not "up" the loopback (lo) interface after boot. This is hard to debug, this has been so for a while (I forgot about it). Works like usual, except extra CPU usage |
| 22:11.04 | streuner | project2501a: sometimes you have just luck and there are people who have knowledge about NFS |
| 22:11.10 | *** join/#debian derchris^ (~derchris@78-86-128-162.zone2.bethere.co.uk) |
| 22:11.14 | engla | does anyone have any ideas what might be wrong, what config file should I edit? |
| 22:11.43 | *** join/#debian Saar (~Saar@216.156.80.182.ptr.us.xo.net) |
| 22:11.43 | *** join/#debian Guest25923 (~admin@ppp201-15.static.internode.on.net) |
| 22:11.43 | *** join/#debian h2oman (~user@cpe-66-74-172-218.socal.res.rr.com) |
| 22:11.58 | *** join/#debian Russell`` (~russell@2a02:40:40:62::4) |
| 22:12.07 | *** join/#debian Dewi (~dewi@sh.disobedi.net) |
| 22:12.09 | *** join/#debian sethrd (~seth@colossus624.startdedicated.com) |
| 22:12.26 | *** join/#debian benji_ (~benji@12.207.18.194) |
| 22:12.35 | *** join/#debian wahooooo0 (~wahooooo@ec2-184-72-7-126.us-west-1.compute.amazonaws.com) |
| 22:12.35 | project2501a | streuner: i want the maintainer for nfs-kernel-server because i got a question for the /etc/init.d/nfs-kernel-server script. ( version 1:1.2.2-4~bpo50+1 ) . line number 104: $PREFIX/bin/rpcinfo -u localhost nfs 3 >/dev/null 2>&1 || RPCMOUNTDOPTS="$RPCMOUNTDOPTS --no-nfs-version 3" . i don't get that. why is the script checking to see if the nfs version 3 is available there? i would think that one would want to maek nfs more friendly to clients w |
| 22:12.35 | project2501a | ith older versions of the protocol. |
| 22:12.40 | *** join/#debian muddo (debian-tor@gateway/tor-sasl/muddo) |
| 22:12.54 | streuner | omg |
| 22:13.01 | *** join/#debian fishsponge (~fishspong@212.44.16.158.ip.redstone-isp.net) |
| 22:13.03 | project2501a | ? |
| 22:13.07 | streuner | bpo... |
| 22:13.17 | *** join/#debian Bry8Star (debian-tor@gateway/tor-sasl/bry8star) |
| 22:13.23 | *** join/#debian StudioD (sdnet@205.185.120.7) |
| 22:13.26 | project2501a | yeah, backport... is that bad? |
| 22:13.39 | *** join/#debian elbing (~elbing@207.Red-2-137-16.dynamicIP.rima-tde.net) |
| 22:13.59 | *** join/#debian Ambush (ambush@209.23.126.25) |
| 22:14.14 | *** join/#debian {{localhost}} (~localhost@d24-150-140-70.home.cgocable.net) |
| 22:14.14 | streuner | well, usually everybody is able to make a backport... |
| 22:14.26 | project2501a | and? |
| 22:14.40 | streuner | usually a DD |
| 22:14.51 | project2501a | *nod* |
| 22:14.55 | project2501a | what does it mean, in this case? |
| 22:14.55 | *** part/#debian derchris^ (~derchris@78-86-128-162.zone2.bethere.co.uk) |
| 22:15.01 | *** join/#debian Maarten (~dutchusa@99-73-209-18.lightspeed.irvnca.sbcglobal.net) |
| 22:15.02 | *** join/#debian Maarten (~dutchusa@unaffiliated/maarten) |
| 22:15.09 | *** join/#debian derchris (~derchris@78-86-128-162.zone2.bethere.co.uk) |
| 22:15.10 | *** join/#debian sacredchao (debian-tor@gateway/tor-sasl/nike) |
| 22:15.21 | streuner | well, i would just find out WHO made it |
| 22:15.29 | *** join/#debian kaeos (~Miranda@90.164.135.241) |
| 22:15.53 | streuner | but its another case WHY you would find him and what should be the reason... |
| 22:16.41 | *** join/#debian drew__ (~drew@rrcs-67-78-3-246.se.biz.rr.com) |
| 22:16.48 | *** join/#debian McMAGIC--Copy (debian-tor@gateway/tor-sasl/mcmagic--copy) |
| 22:17.06 | *** join/#debian alphur (~joshua@cpe-76-90-165-115.socal.res.rr.com) |
| 22:17.46 | project2501a | back to our regular programming. |
| 22:17.49 | *** join/#debian jernux (~jerry@pool-71-105-117-41.lsanca.dsl-w.verizon.net) |
| 22:18.10 | *** join/#debian mvooght (~mvooght@108-60-163-138.sktn.hsdb.sasknet.sk.ca) |
| 22:18.22 | *** join/#debian Methamorpheus (~Methamorp@p549394F7.dip0.t-ipconnect.de) |
| 22:18.25 | *** join/#debian red2kic (~red2kic@unaffiliated/red2kic) |
| 22:19.05 | dudz_ | can i help project2501a ? |
| 22:19.21 | dudz_ | i don't believe in currency |
| 22:19.31 | project2501a | neither does greece :) |
| 22:19.37 | dudz_ | nice :) |
| 22:19.40 | *** join/#debian Kevin` (~kevin@nelson.kwzs.be) |
| 22:19.46 | *** join/#debian elky (~melissa@ubuntu/member/pdpc.professional.elky) |
| 22:19.52 | project2501a | hey dudz_ yeah, i got a little problem with /etc/init.d/nfs-kernel-version |
| 22:19.54 | streuner | project2501a: lol |
| 22:20.48 | dudz_ | did you try using samba instead of nfs project2501a ? |
| 22:20.49 | project2501a | dudz_: if you can scroll back, you can see my issue. it is still bad ettiquete to repeat one self, right? especially if what one wrote was 5 lines long, correct? |
| 22:21.01 | *** mode/#debian [+l 1104] by debhelper |
| 22:21.01 | *** join/#debian jhutchins_lt (~jonathan@64-151-37-66.dyn.everestkc.net) |
| 22:21.02 | project2501a | not an option |
| 22:21.11 | project2501a | dudz_: netbooting a live image. |
| 22:21.43 | project2501a | 10k core cluster |
| 22:21.43 | *** join/#debian XSoul (~XRule@tooms.ddns.cablebg.net) |
| 22:22.05 | *** join/#debian tgies (~tgies@wopr.omaha.tgies.net) |
| 22:22.53 | project2501a | aha! |
| 22:23.01 | *** join/#debian Gilde (~Gilde@dslb-092-076-130-254.pools.arcor-ip.net) |
| 22:23.06 | project2501a | karmen nfs siantiago left a clue |
| 22:23.26 | project2501a | node00:~# rpcinfo -u localhost nfs |
| 22:23.27 | project2501a | rpcinfo: RPC: Program not registered |
| 22:23.27 | project2501a | program 100003 is not available |
| 22:23.33 | *** join/#debian cdahmedeh (~cdahmedeh@CPE001cdfab341a-CM001225409602.cpe.net.cable.rogers.com) |
| 22:23.55 | *** join/#debian lcafiero (~lcafiero@adsl-99-163-5-114.dsl.pltn13.sbcglobal.net) |
| 22:24.09 | *** join/#debian smica_ (~smica@109-61-48-99.adsl-pool.dravanet.hu) |
| 22:24.10 | *** join/#debian afiestas (~afiestas@business-89-133-214-120.business.broadband.hu) |
| 22:24.44 | *** join/#debian {{localhost}} (~localhost@unaffiliated/thegeek1024) |
| 22:25.03 | *** join/#debian Orphis_ (~quassel@belgarath.moomoocamp.net) |
| 22:25.05 | *** join/#debian RA3OR (angel@188.214.222.57) |
| 22:25.26 | *** join/#debian elbing (~elbing@207.Red-2-137-16.dynamicIP.rima-tde.net) |
| 22:25.35 | *** join/#debian jmcantrell (u324@gateway/web/irccloud.com/x-faytvexubsvjnhci) |
| 22:25.39 | project2501a | i think i may have a clue. nfs is tcp or udp? |
| 22:26.22 | *** join/#debian katsrc (~quassel@cpe-69-203-198-189.nyc.res.rr.com) |
| 22:26.39 | project2501a | and what is the damn order by which you shut down nfs? |
| 22:26.48 | *** join/#debian Pryon (~Pryon@animalcules.com) |
| 22:26.49 | project2501a | first -common and then -kernel-server? |
| 22:27.03 | *** join/#debian kellyh (~kelly@5e02d647.bb.sky.com) |
| 22:27.05 | Arrowmaster | project2501a: its both tcp and udp |
| 22:27.27 | project2501a | Arrowmaster: cool, then i am right: i am getting nfs here which is offered only in tcp |
| 22:27.34 | *** join/#debian jmcantrell (u324@gateway/web/irccloud.com/x-edotkluqzlfoygru) |
| 22:27.42 | project2501a | so the netboot makes sense to fail if it is asking for udp and not finding any |
| 22:27.53 | Arrowmaster | well it was originally udp only, no clue if udp is still used |
| 22:28.32 | *** part/#debian franco (~franco@89.81.118.26) |
| 22:28.55 | *** join/#debian chemist (chemist@lair.spookfactory.co.uk) |
| 22:29.17 | simonlnu | project2501a: nfs defaults to udp. enable tcp explicitly. first common then server, to start them, then flip for stop, but often i find there isn't a difference. |
| 22:29.41 | project2501a | *nod* |
| 22:30.16 | simonlnu | for netboot, do pay attention to order, but if both are already started on the server, it won't matter much. |
| 22:30.29 | *** mode/#debian [+o niko] by ChanServ |
| 22:30.29 | *** mode/#debian [-qo $~a niko] by niko |
| 22:30.35 | *** join/#debian jmcantrell (u324@gateway/web/irccloud.com/x-cpcxcdsbmcbbevdw) |
| 22:30.39 | simonlnu | you might want tcp for netboot anyway, tends to be less traffic, and more reliable. |
| 22:30.41 | project2501a | what do you do in an nfs server, if you have to upgrade nfs-kernel-server ? i mean, how do the clients handle it? do they try to reconnect sometime in the future, if you shut down nfs-kernel-server ? |
| 22:31.00 | *** mode/#debian [+l 1098] by debhelper |
| 22:31.21 | project2501a | simonlnu: i am getting an error: "nfs server 10.11.12.1 is not responding: mount: i/o error" |
| 22:31.35 | *** join/#debian Mr_Queue (~Mr_Queue@50-56-126-172.static.cloud-ips.com) |
| 22:31.48 | project2501a | which is not very informative, and in my current sleepless state of mind, makes me pick up the first user and make soap out of him |
| 22:32.06 | project2501a | i am jack's furious LART of life. |
| 22:32.19 | simonlnu | yeh, you'll need to enable rpcdebug probably |
| 22:32.29 | *** join/#debian L0C41H05T (~localhost@unaffiliated/thegeek1024) |
| 22:32.32 | project2501a | where do i start reading on how to do that? |
| 22:32.59 | project2501a | man -k ofcourse |
| 22:33.01 | project2501a | thanks |
| 22:33.22 | simonlnu | rpc<tab>rpcdebug -vh |
| 22:33.26 | simonlnu | woops |
| 22:33.29 | simonlnu | rpcdebug -vh |
| 22:33.39 | project2501a | reading the man page as we speak |
| 22:33.54 | simonlnu | excellent |
| 22:33.59 | project2501a | simonlnu: why does your name remind me of luis wu, the protagonist from ringworld? |
| 22:34.33 | streuner | its just wrong |
| 22:34.44 | *** join/#debian L0C41H05T (~localhost@unaffiliated/thegeek1024) |
| 22:34.45 | simonlnu | it's not louis wu. it's another language entirely |
| 22:35.00 | warrenchild | jelly-home: I got my RAID set up this is what I did. 4 500GB HDD, each with a 1GB partition and the rest of the drive another partition. The one GB partitions I put in a RAID 1 with 3 drives and one hot spare mounted to /boot, the other partitions I put in a RAID 5 with 3 drive and one hot spare and mounted to /. everything installed perfectly and system starts. Now whn I replace on of the draves to a fresh one and start the machine, |
| 22:35.00 | warrenchild | <PROTECTED> |
| 22:35.26 | project2501a | 4x500gb and each drive has 1GB partition? |
| 22:35.28 | project2501a | erh? |
| 22:35.47 | project2501a | what does the 1GB partition hold? |
| 22:36.07 | project2501a | oh, yeah |
| 22:36.22 | project2501a | warrenchild: "reasons grub-legacy fails, for 5,000 alex" |
| 22:37.00 | *** join/#debian pbn (pbn@wopr.geekshells.org) |
| 22:37.02 | *** join/#debian _linuxftw (~anonymous@dyn1207-175.wlan.ic.ac.uk) |
| 22:37.03 | *** join/#debian Generator (~aj@89-181-1-126.net.novis.pt) |
| 22:37.03 | project2501a | man grub still chokes on 100TB partitions as boot partitions. |
| 22:37.21 | _linuxftw | does it? that sucks. |
| 22:37.31 | streuner | _linuxftw: :-P |
| 22:37.52 | streuner | 100TB, what a joke :-/ |
| 22:38.06 | streuner | lots of pron :-) |
| 22:38.09 | project2501a | _linuxftw: in a way, the maintainers are right to do so : you should not be booting from 100TB in the first place |
| 22:38.12 | project2501a | streuner: i wish |
| 22:38.28 | project2501a | all there is int here are GATTAGATATATATCATAAACATACAATACATAA files |
| 22:38.32 | _linuxftw | I bet that's what they said about 32 bit addresses |
| 22:38.52 | project2501a | streuner: see you when i get up to 5PB |
| 22:39.09 | project2501a | now that will be a hell of a partition to maintain. |
| 22:40.49 | warrenchild | project2501a you think I should make the 1GB patition for /boot to a 256MG partition? |
| 22:41.10 | project2501a | 512MB max. how many kernels do you plan to store there? |
| 22:41.17 | warrenchild | 1 |
| 22:41.22 | warrenchild | I am using virtual machines |
| 22:41.25 | project2501a | 256 is enough then. |
| 22:41.35 | project2501a | what is it with virtual machines these days? |
| 22:41.48 | *** part/#debian engla (~ulrik@wikipedia/Sverdrup) |
| 22:41.52 | warrenchild | runs more servers more efficiently |
| 22:42.01 | warrenchild | you are only suposed to do 1 task with every server |
| 22:42.16 | warrenchild | one server for files, one server for mail, 1 server blah blah blah |
| 22:42.23 | warrenchild | makes it run smoother |
| 22:43.03 | *** join/#debian toropisco (~vorbote@unaffiliated/vorbote) |
| 22:43.52 | *** join/#debian sjs205 (~sjs205@host86-144-215-42.range86-144.btcentralplus.com) |
| 22:48.03 | aspect | "efficient" isn't the word |
| 22:48.12 | *** join/#debian hays_ (~hays@unaffiliated/hays) |
| 22:48.25 | *** join/#debian Drew (~drew@rrcs-67-78-3-246.se.biz.rr.com) |
| 22:48.26 | warrenchild | aspect: why not? it workes wonders for me so far |
| 22:48.32 | *** join/#debian dvs (~me@cwv.teksavvy.com) |
| 22:49.36 | *** join/#debian elbing (~elbing@207.Red-2-137-16.dynamicIP.rima-tde.net) |
| 22:50.16 | flupps | If I have a driver that is compiled into the kernel, but have a newer version of that driver as a kernel module. Is there an easy way to skip the non-module in favor for the module one? |
| 22:51.19 | simonlnu | no |
| 22:52.21 | simonlnu | rebuild your kernel |
| 22:52.31 | flupps | simonlnu: ok, thanks |
| 22:52.40 | *** join/#debian ssfdre38 (~ssfdre38@unaffiliated/ssfdre38) |
| 22:52.49 | simonlnu | np |
| 22:54.38 | *** join/#debian kelsoo (~kelsoo@86.53.50.178) |
| 22:55.45 | *** join/#debian abrotman (~abrotman@pdpc/supporter/active/abrotman) |
| 22:55.47 | *** join/#debian SSL` (~Unix@nat/hp/x-lrknbqrsvtrsjglo) |
| 22:57.13 | *** join/#debian galfly (~galfly@unaffiliated/galfly) |
| 22:58.53 | *** join/#debian cromag (cromag@irssi/user/cromag) |
| 22:59.03 | *** join/#debian erore (opera@hve-0425.koleje.cuni.cz) |
| 22:59.06 | *** join/#debian WormFood (~wormfood@58.60.216.141) |
| 22:59.24 | *** join/#debian opusculum (~rickbol@cpe-174-096-213-166.carolina.res.rr.com) |
| 23:00.00 | *** join/#debian elbing (~elbing@207.Red-2-137-16.dynamicIP.rima-tde.net) |
| 23:00.00 | *** join/#debian K_REY_C (~kyconway@adsl-70-238-203-50.dsl.lbcktx.sbcglobal.net) |
| 23:00.47 | *** join/#debian Brigo (~Brigo@139.182.60.213.dynamic.mundo-r.com) |
| 23:01.51 | erore | I have a simple question. How do I install debian from a usb stick? I tried - google -> guides that use logic install linux to prepare the usb stick so that u can install linux, unetbootin with debian-6.0.1a-i386-netinst.iso but I end up as the installer desperately needs cd drive. So my sit, I have windows and a stick (usb) and I want to install debian. |
| 23:03.29 | dvs | erore: use dd for windows to copy the .iso image to the USB stick |
| 23:03.34 | babilen | !usb install |
| 23:03.34 | dpkg | You can install Debian from a USB stick/thumbdrive/pen drive/key on x86 systems, as long as your system's BIOS can boot from USB. Details are in the Installation Guide, see http://www.debian.org/releases/stable/i386/ch04s03 and ask me about <install debian> for hybrid CD/DVD images. https://launchpad.net/win32-image-writer/+download to prepare from Windows. BIOS can't boot from USB? Use http://www.plop.at/en/bootmanager.html |
| 23:03.41 | abrotman | erore: it's in the installation manual |
| 23:04.17 | babilen | dvs: It was mentioned that dd for windows does not work well. I can't give you the particulars, but the image writer is the recommended tool. |
| 23:04.33 | dvs | rewrites his own image |
| 23:05.41 | erore | babilen: yep, but that is the guide with logic install linux so that u can install debian :-) I have windows, so things like cat debian.iso > /dev/sdX are no go |
| 23:06.04 | *** join/#debian TheAvatar (TheAvatar@crew.eushells.com) |
| 23:06.22 | babilen | erore: Did you read the factoid and what I just said? :) |
| 23:06.28 | _linuxftw | erore, you can setup a virtual machine and run a bootable debian ISO, then use that VM to create your USB installer |
| 23:06.35 | abrotman | wtf |
| 23:07.58 | babilen | erore: fwiw there is also the win32 installer (some exe in the image) that will kick-off an installation from within ms windows. -- /msg dpkg win32 |
| 23:09.00 | erore | babilen: yep but i think this is just the way i took with unetbootin which simply makes usb bootable stick from a given linux iso, BUT the problem is the installer goes rather hard headed as it won't continue without a cd-rom --- the problem is, I believe, in debian-6.0.1a-i386-netinst.iso itself as it is meant to be booted from a cdrom |
| 23:09.28 | babilen | erore: The problem is with unetbootin |
| 23:09.35 | *** join/#debian jmcantrell (u324@gateway/web/irccloud.com/x-srlgyshjlyliktow) |
| 23:09.38 | erore | _linuxftw: :-)) I want a SIMPLE way :-) |
| 23:10.12 | streuner | erore: a simple way is to read <ig> |
| 23:10.25 | streuner | and not |
| 23:10.34 | erore | babilen: i am going to give a try to https://launchpad.net/win32-image-writer/+download :-) |
| 23:10.34 | streuner | dpkg, ruby goldberg install |
| 23:10.34 | dpkg | streuner: KCI error, or a problem with the Keyboard-Chair Interface. |
| 23:10.39 | kalyplato | hello, is there a way to periodically erase ip logs from ssh access ? thanks |
| 23:10.56 | _linuxftw | yes, there is |
| 23:11.00 | erore | streuner: a simple way is to click, click, click and finished :-) |
| 23:11.00 | *** mode/#debian [+l 1092] by debhelper |
| 23:11.05 | streuner | dpkg, rube goldberg install |
| 23:11.06 | dpkg | "Hi! I want to install Debian with a 2.6.x kernel on a machine, but I can't boot from floppies, and I can't boot from CD-ROM, and I have no network card. I have only a USB dot matrix printer and a punch card reader. Wait, the card reader just fell on the floor and broke." |
| 23:11.10 | *** join/#debian debsan (~debsan@190.245.74.16) |
| 23:12.16 | *** join/#debian Agiofws (~Agiofws@athedsl-427655.home.otenet.gr) |
| 23:12.23 | abrotman | kalyplato: the system already does that |
| 23:12.32 | _linuxftw | kalyplato, just setup a simple command as a cron job. The command could be `rm /var/log/whatever.log` |
| 23:12.37 | babilen | erore: Please also note what I said about the win32 installer. Honestly, I can't make it any easier for you. |
| 23:13.03 | Arrowmaster | babilen: you have to have it on install media first though |
| 23:13.56 | kalyplato | is there a specific .log file for ssh ? sounds logical indeed.. |
| 23:14.15 | babilen | Arrowmaster: I am sure that ms windows can "mount" iso images somehow. And there is still http://goodbye-microsoft.com/debian (no idea how well that is supported these days though) |
| 23:14.22 | _linuxftw | Have a look, different logging systems log things differently |
| 23:15.03 | Arrowmaster | babilen: there is 3rd party software to mount iso's in windows |
| 23:15.04 | *** join/#debian Ambagasdowa (~leviathan@189.251.131.75) |
| 23:15.23 | *** join/#debian Kevin` (~kevin@nelson.kwzs.be) |
| 23:15.57 | *** join/#debian Bilaw (~Bilaw@85-220-87-101.dsl.dynamic.simnet.is) |
| 23:16.42 | abrotman | kalyplato: the system already rotates your logs .. and it removes them at a certain point, what's wrong with that? |
| 23:16.53 | kalyplato | no its not wrong |
| 23:17.06 | kalyplato | just want to ensure that and control the period if possible |
| 23:17.18 | *** join/#debian ChrisPartridge (~az@219-90-195-66.static.adam.com.au) |
| 23:17.20 | *** join/#debian tobias_ (~tobias@pD95524D8.dip.t-dialin.net) |
| 23:17.35 | *** join/#debian zz_Cogito (~Cogito@2001:4ba0:fff1:c2::2) |
| 23:17.47 | *** join/#debian Bartzy (~Bar@85.64.236.16.dynamic.barak-online.net) |
| 23:20.56 | *** join/#debian strato_ (~ivo@f048073153.adsl.alicedsl.de) |
| 23:21.05 | project2501a | are there any good tutorials for dhcpd3 ? the manual is horrible. i googled, but i have not come up with something satisfactory. i was looking for a book that reads like the o'reilly series |
| 23:21.14 | project2501a | even one of those mini books would be nice. |
| 23:21.38 | *** join/#debian Hut (~ubuser@chello080108052003.20.11.vie.surfer.at) |
| 23:22.24 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 23:22.26 | erore | babilen: I tried https://launchpad.net/win32-image-writer/+download but it only writes img files not iso files. Any suggestion? |
| 23:23.54 | *** join/#debian Bartzy (~Bar@85.64.236.16.dynamic.barak-online.net) |
| 23:24.58 | *** join/#debian mharrison (~matt@c-67-167-142-116.hsd1.mi.comcast.net) |
| 23:25.40 | *** join/#debian m4ggus (~m4ggus@p5DD53F13.dip.t-dialin.net) |
| 23:26.27 | *** join/#debian TheAvatar (TheAvatar@crew.eushells.com) |
| 23:26.45 | *** join/#debian NightMiles (~nights@pool-173-59-64-30.phlapa.east.verizon.net) |
| 23:26.54 | *** part/#debian erore (opera@hve-0425.koleje.cuni.cz) |
| 23:27.15 | *** join/#debian Theoden (~quassel@c-98-234-161-226.hsd1.ca.comcast.net) |
| 23:27.35 | *** join/#debian urmam4 (~test@52485B18.cm-4-1b.dynamic.ziggo.nl) |
| 23:27.48 | *** join/#debian Amorphous (jan@unaffiliated/amorphous) |
| 23:28.28 | *** join/#debian pierrep (~pierrep@65.93.15.238) |
| 23:28.32 | Corey | Is there a simple way to query what version of puppet is in various pkg repos? |
| 23:28.57 | Arrowmaster | ,versions puppet |
| 23:28.57 | judd | Package puppet on i386 -- lenny: 0.24.5-3; lenny-backports: 2.6.2-4~bpo50+1; squeeze: 2.6.2-4; squeeze-backports: 2.6.7-2~bpo60+1; wheezy: 2.6.7-2; sid: 2.6.8-1 |
| 23:30.36 | *** join/#debian km (~km@little-black-box.vmware.com) |
| 23:30.44 | *** join/#debian MUILTFN (~MLINTH@adsl-98-80-208-60.mcn.bellsouth.net) |
| 23:31.32 | *** join/#debian phantomcircuit_ (~phantomci@2001:470:1f05:848:4687:fcff:fedb:8a6c) |
| 23:31.58 | *** join/#debian ICEBreakPoint (~d3mux32@89.181.147.126) |
| 23:32.38 | *** join/#debian shanepardue_ (~quassel@173-14-199-153-independence.hfc.comcastbusiness.net) |
| 23:35.52 | *** join/#debian satellit_ (~satellit@2002:d064:94dc:0:219:d1ff:fe73:14e6) |
| 23:36.31 | Bilaw | hello, there from ReykjavÃk, Iceland! I cannot sudo. âvisudoâ gives me â%sudo ALL=(ALL) ALLâ, is this not correct? |
| 23:37.02 | _linuxftw | what's in /etc/sudoers? |
| 23:37.21 | Arrowmaster | you probably arent in the sudo group |
| 23:37.40 | Bilaw | _linuxftw: ârootALL=(ALL) ALLâ |
| 23:37.48 | *** join/#debian Neo (~Neo@unaffiliated/alpsinc) |
| 23:38.17 | *** join/#debian I-are- (~joshua@c-24-99-210-169.hsd1.ga.comcast.net) |
| 23:38.20 | *** join/#debian llua (~llua@unaffiliated/llua) |
| 23:38.21 | _linuxftw | isn't there supposed to be a space there? |
| 23:38.23 | Bilaw | Arrowmaster: I come from Ubuntu, and was used to being in the list by default⦠Am not to sure which my group is⦠|
| 23:38.36 | _linuxftw | root<space>ALL=(ALL) ALL? |
| 23:38.43 | *** part/#debian aspect (~aspect@abstracted-spleen.org) |
| 23:38.48 | *** join/#debian Ergo^_ (~ergo@hyp-p-107.pabianice.msk.pl) |
| 23:39.15 | themill | Bilaw: "adduser yourusername sudo" then log out and log back in |
| 23:39.20 | karlpinc_ | Bilaw: Why would you want to give anyone with a login root priviliges? That makes relatively minor security problems a lot more severe. |
| 23:39.24 | Arrowmaster | Bilaw: you dont have access to sudo by default in debian |
| 23:39.27 | I-are- | can anyone help me troubleshoot why my eth0 is only pulling 30 B/s average. It is a fresh install of ubuntu 9.10 (which is not supported, but newer versions crash). The nic seemed to work fine under windows, but now it is super slow. |
| 23:39.35 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 23:39.45 | karlpinc_ | !tell I-are- about ubuntu |
| 23:39.50 | Arrowmaster | karlpinc_: hes not? |
| 23:40.20 | Bilaw | karlpinc_: I understand, but being the only one to use the computer, I tend to think it will make things easier for me. |
| 23:40.30 | *** join/#debian MrCoffee (~glen@unaffiliated/ridout) |
| 23:40.45 | Arrowmaster | Bilaw: just do what themill said to do |
| 23:40.50 | karlpinc_ | Bilaw: I find typing su instead to be fine. Leave a window logged in that way if you like. |
| 23:41.12 | *** join/#debian xPhilosx (~asdfa@64-139-76-219-Pima.hfc.comcastbusiness.net) |
| 23:41.33 | xPhilosx | quick question, how do you stop aptitude from trying to continually install a broken package? |
| 23:41.50 | karlpinc_ | Bilaw: Yes, otherwise add yourself to the sudo group. That at least makes only your account vulnerable. |
| 23:41.55 | _linuxftw | can you remove the package? |
| 23:41.58 | *** join/#debian icesword (~nanren@117.136.22.161) |
| 23:43.07 | Bilaw | alright, all. Have used the command suggested by themill. It seems to have worked, but Iâll have to log out, then? Alright⦠Thanks for the help! |
| 23:43.09 | *** part/#debian icesword (~nanren@117.136.22.161) |
| 23:43.42 | xPhilosx | _linuxftw, I can't remove it because its a kernel |
| 23:44.01 | xPhilosx | but on my Xen domU it fails to autoinstall so I had to fix it manually |
| 23:44.15 | xPhilosx | but the package manager complains and fails the install every time I use it |
| 23:44.45 | xPhilosx | I really just want aptitude to stop complaining about it and ignore it |
| 23:44.59 | *** join/#debian frz (~frz@jaim.at) |
| 23:45.12 | *** part/#debian Bilaw (~Bilaw@85-220-87-101.dsl.dynamic.simnet.is) |
| 23:45.33 | xPhilosx | basically the image is built, but it doesn't play nicely with grub, so I had to edit grub.conf |
| 23:45.46 | *** part/#debian Guest88900 (~frz@jaim.at) |
| 23:45.57 | xPhilosx | if I aptitude remove kernel-image it will kill the entire kernel |
| 23:46.03 | *** join/#debian simonlnu (simon@unaffiliated/simonrvn) |
| 23:47.09 | *** join/#debian jk (~jochem@2a02:2308::216:3eff:fe54:d38) |
| 23:47.25 | *** join/#debian drew__ (~drew@rrcs-67-78-3-246.se.biz.rr.com) |
| 23:47.41 | *** join/#debian hays (~hays@unaffiliated/hays) |
| 23:48.59 | *** join/#debian scampbell (~scampbell@mail.scampbell.net) |
| 23:50.42 | *** join/#debian arif-ali (~arif-ali@88-111-135-136.dynamic.dsl.as9105.com) |
| 23:51.44 | *** join/#debian SgrA (~SgrA@unaffiliated/sgra) |
| 23:52.03 | *** join/#debian elbing (~elbing@207.Red-2-137-16.dynamicIP.rima-tde.net) |
| 23:52.11 | *** join/#debian slvmchn (~slvmecha@c-24-91-117-140.hsd1.ma.comcast.net) |
| 23:55.02 | *** join/#debian Bjoern-Erik (~unknown@112.198.77.20) |
| 23:55.10 | macrobat | xPhilosx: maybe it is a failing postinst script or some script in /etc/kernel. wont grub.conf be overwritten later anyway? |
| 23:57.31 | xPhilosx | macrobat, update-grub fails to recognize the correct disk structure |
| 23:57.57 | xPhilosx | its easy fixed by just manually updating it after the package fails (since it builds everything anyway) |
| 23:58.07 | xPhilosx | but now I just want to silence aptitude :) |
| 23:59.23 | macrobat | is aptitude co,plaining over update-grub failing and thinking the kernel pkg is unconfigured? |
